WWW.DOC.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Различные документы
 

Pages:     | 1 ||

«ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование ...»

-- [ Страница 2 ] --

элиминировались 2 группы – «не реагируют на условия внешней среды» и «более скороспелые в ПЛ ВИР», однако на ДОС ВИР группа «самые скороспелые» существенно возросла. Очевидно, дагестанские ячмени сильно подвержены влиянию условий выращивания, т.е. имеют высокую норму реакции.

% образцов

–  –  –

3.2.2. Чувствительность к фотопериоду.

Время колошения у ячменя в основном определяется тремя факторами:

прежде всего, это гены типа развития, нечувствительности к фотопериоду и собственно скороспелости.

М 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

–  –  –

Рис. 3.2.2.1. ПЦР анализ геномной ДНК образцов местного ячменя из

Дагестана с помощью маркеров, разработанных для идентификации:

а – доминантного (276+269+70 пн) и рецессивного (276+339 пн) аллеля гена Ppd-H1 (Jones et al., 2008);

б – доминантного аллеля (1433 пн) гена Ppd-H2 (Kikuchi et al., 2009);

в – рецессивного аллеля (1500 пн) гена Ppd-H2 (Kikuchi et al., 2009).

1 – к-23819; 2, 3 – к-23820; 4, 5 – к-23821; 6, 7 – к-23822; 8, 9 – к-23823; 10, 11

– к-23825; 12, 13 – к-23827; 14, 15 – к-23830; 16, 17 – к-25615; 18, 19 – кк-17438; 22, 23 – к-21772; 24, 25 – к-21808; 26,27 – к-21817;

28,29 – к-23822; 30,31 – к-26290; 32, 33 – к-26295; 34, 35 – к-26297; 36,37 – к- 28209; 38 – к-28211.

Изучили аллельное разнообразие генов Ppd-H1 и Ppd-H2, участвующих в контроле продолжительности периода всходы–колошение. Доминантный аллель Ppd-H1 контролирует быструю реакцию на удлинение фотопериода и раннее колошение в условиях длинного дня, а при коротком фотопериоде более раннее колошение контролирует доминантный ген Ppd-H2.

С помощью молекулярных маркеров, разработанных H. Jones с соавторами (2008) и R. Kikuchi с соавторами (2009) идентифицировали аллели генов Ppd-H1 и Ppd-H2 у местных образцов, а также сортов и линий из Дагестана (рис. 3.2.2.1).

Сравнили аллельные сочетания Ppd-H1 и Ppd-H2 у 169 образцов местного ячменя, а также 26 сортов и селекционных линий. Среди местных образцов наиболее распространено сочетание ppd-H1/Ppd-H2, которое обеспечивает скороспелость в условиях короткого дня (111 образцов). Для 46 образцов характерно сочетание двух доминантных аллелей Ppd-H1/Ppd-H2;

12 форм имеют аллели Ppd-H1/ppd-H2 и могут быть источниками скороспелости в условиях длинного дня. Носители рецессивных аллелей ppdH1/ppd-H2 не обнаружены.

У сортов и линий наиболее распространено сочетание доминантных аллелей Ppd-H1/Ppd-H2 (10 образцов), для семи образцов характерно сочетание для пяти – Сочетание Ppd-H1/ppd-H2, ppd-H1/Ppd-H2.

рецессивных аллелей ppd-H1/ppd-H2 выявлено у четырех образцов.

Однородный по морфологическим признакам, а также RAPD и ISSR спектрам, образец к-15008, выделившийся в течение трех лет по скороспелости в Дагестане, имеет сочетание аллелей ppd-H1/Ppd-H2, то есть адаптирован к условиям короткого дня.

Растения другого скороспелого в Дагестане образца к-15013 оказались носителями доминантного аллеля Ppd-H1 и рецессивного – ppd-H2, что может быть связано с его неоднородностью: к-15013 представлен 4-мя разновидностями и неоднороден по RAPD и ISSR маркерам. Другой полиморфный образец – к-15027, выделившийся по скороспелости в Пушкине в условиях длинного дня, имеет сочетание аллелей ppd-H1/PpdH2, что характерно для образцов, произрастающих в условиях длинного дня.

Помимо неоднородности этих форм, возможное объяснение выявленного противоречия – влияние Vrn-Н-генов, изучение аллельного полиморфизма которых нами не проводилось.

–  –  –

Таким образом, среди местных дагестанских ячменей превалируют (90%) носители доминантного аллеля Ppd-H2; доминантный аллель Ppd-H1 отмечен у 27% образцов местного ячменя. В процессе селекции происходит замещение генотипов с доминантным аллелем Ppd-H2 не приспособленными к местным условиям генотипами с доминантным аллелем Ppd-H1: среди сортов и селекционных линий носители доминантных аллелей этих генов составляют 53% и 63% соответственно (табл. 3.2.2.1; 3.2.2.2).

Рецессивный ген контролирует нечувствительность к eam8 фотопериоду. Скороспелые нечувствительные к фотопериоду сорта Maja и Mari являются индуцированными мутантами по гену Eam8, а Kinai 5, Kagoshima Gold и Русский ранний – естественными мутантами. При 10часовом фотопериоде, низкой дневной (10°С) и высокой ночной (20°С) температурах eam8 обусловливает желтую окраску проростков ячменя (Yasuda, 1977). В климатической камере изучили 250 образцов ячменя.

Маркерным признаком экспрессии гена служила желтая окраска проростка.

Выявили 8 предположительно нечувствительных к короткому дню образцов и 20 гетерогенных по маркерному признаку форм.

Таблица 3.2.

2.3. Характеристика образцов ярового ячменя из Дагестана по ФПЧ (ПЛ ВИР, вегетационный опыт, 2014 г.)

–  –  –

Примечание. Т1 и Т2 – продолжительность периода всходы-колошение (сут) у растений ячменя, выращенных соответственно в условиях длинного естественного и короткого 12часового дня;

Т2-Т1 – задержка колошения растений на коротком дне по сравнению с длинным (сут).

Кфпч = Т2/Т1 – коэффициент фотопериодической чувствительности растений.

Оценили фотопериодическую чувствительность (ФПЧ) 14 выделенных образцов ярового ячменя. Растения выращивали в условиях естественного длинного (18 ч) и короткого (12 ч) фотопериода. Выделили 4 источника слабой ФПЧ: к-14891, к-18178, к-21812, к-23785 (табл. 3.2.2.3), у которых коэффициент фотопериодической чувствительности не превышал 1,15 и был сравним с КФПЧ образцов с геном eam8 (Mona и Kinae 5).

Для молекулярных исследований выбрали образец к-14891 – предполагаемый носитель гена eam8, а также сорта Mona, Mari, Kinai 5 (генотип eam8eam8), Белогорский (Eam8Eam8) и скороспелый сорт Bankuti Korai. Результаты ПЦР с ДНК отобранных генотипов представлены на рис. 3.2.2.2. Использованные в работе праймеры разработаны для идентификации делеции в последовательности гена Eam8 сорта Kinai 5, поэтому на электрофореграмме этого сорта ампликон отсутствует. У остальных образцов фрагмент имеет примерно одинаковую подвижность.

Аналогичный фрагмент сорта Bonus, приведенный в Международном генном банке (GenBank JN180296.1), имеет длину 580 пн, находится в диапазоне с 1302 по 1881 нуклеотид полной последовательности гена и включает фрагменты интрона и экзона. На рис. нуклеотидная 3.2.2.3.

последовательность изученного фрагмента сорта Bonus приведена в качестве референсной.

По результатам секвенирования фрагментов гена eam8 у растений образца к-14891 обнаружили мутацию в смысловой последовательности.

Делеция нуклеотида Т могла привести к сдвигу рамки считывания, а, значит, к существенному изменению предполагаемой аминокислотной последовательности. В литературе аналогичные изменения описаны у мутанта mat-a.11 (eam8eam8), полученного при воздействии гамма лучей на сорт Bonus (Zakhrabekova et al., 2012) (рис. 3.2.2.3). Таким образом, у образца к-14891 нами впервые выявлена мутация, обусловленная делецией единичного нуклеотида в смысловой области гена Eam8. Такое изменение в структурной части гена может приводить к образованию дефектного белка и, как следствие – нечувствительности к фотопериоду.

Рисунок 3.2.

2.2. Электрофореграммы фрагмента гена Eam8 у образцов: 1, 2 – Mona; 3, 4 – Mari; 5, 6 – Белогорский; 7, 8 – Kinae 5; 9, 10 – Bankuti Korai; 11, 12 – к-14891; М – маркер молекулярного веса.

Рисунок 3.2.

2.3. Выравнивание секвенированных последовательностей фрагмента гена Eam8 образца к-14891, сорта Bonus (GenBank: JN180296.1) и рецессивного аллеля eam8 мутанта mat-a.11 сорта Bonus.

–  –  –

3.3.1. Устойчивость ячменя к облигатным паразитам Устойчивость к мучнистой росе Устойчивость к Blumeria graminis (DC.) Golovin ex Speer f. sp. hordei Marchal 265 образцов ячменя оценивали на ДОС ВИР в период колошения и в фазу молочной спелости зерна с помощью шкалы от 1 (устойчивость очень низкая) до 9. В 2012-2014 гг. наблюдали эпифитотийный уровень развития болезни. На жестком инфекционном фоне первоначально выделили 5 образцов, поражение которых не превышало 7 баллов, в 2014 г. устойчивость проявили лишь 2 образца: к-23787 и к-28212 (табл. 3.3.1.1).

Выделенные в Дагестане формы, которые были высеяны на опытном поле ПЛ ВИР, оказались устойчивыми (7 баллов) и к местной популяции гриба, то есть выявленные нами устойчивые к мучнистой росе образцы ячменя могут представлять интерес для селекции не только в Дагестане, но и в других регионах страны.

Таблица 3.3.

1.1. Образцы ячменя, выделившиеся по устойчивости к мучнистоой росе (ДОС ВИР, 2012 – 2014 гг.)

–  –  –

На ДОС ВИР оценили также 39 линий ячменя, несущих ранее идентифицированные гены устойчивости к мучнистой росе. Среди них образцы к-30225, несущий ген mlo11, и к-31011 (Mla i) характеризовались наиболее высокой устойчивостью в 2013 г. (9 баллов); поражение 13 линий составило 7 баллов (табл. 3.3.1.2).

В лаборатории при искусственном заражении интактных растений оценили ювенильную устойчивость к северо-западной популяции гриба двух выделенных форм и 47 линий с известными генами устойчивости. Оба образца оказались гетерогенны по изучаемому признаку. Поражение устойчивых растений (88% от числа изученных) образца к-28212 составляло 7–9 баллов, уровень экспрессии устойчивого компонента (80% растений) образца к-23787 несколько ниже: 5–7 баллов. Практически не поражались грибом 11 линий с известными генами устойчивости к грибу, 2 формы оказались гетерогенными (табл. 3.3.1.2).

Таблица 3.3.

1.2. Степень поражения мучнистой росой линий ячменя с известными генами устойчивости (ДОС ВИР, 2013, 2014 гг.; ПЛ ВИР, 2014 г.)

–  –  –

С помощью молекулярных маркеров, разработанных P. Piffanelli с соавторами (2004), у образцов к-23787 и к-28212 обнаружили растения, несущие рецессивные (функциональные) аллели mlo11 (рис. 7). Семнадцать из 26 проанализированных растений образца к-28212 были гомозиготны по рецессивному аллелю mlo11, 9 растений несли доминантные аллели в гомозиготном состоянии. Среди 34 растений образца к-23787 обнаружили одно гетерозиготное по аллелям локуса mlo11 растение. Тем не менее, это растение и ряд других характеризовались устойчивостью к грибу, т.е.

образец к-23787 защищен другим (другими) генами устойчивости.

–  –  –

Ген mlo11 был обнаружен у местных форм ячменя из Эфиопии и в настоящее время широко распространен в современных сортах (Piffanellietal., 2004). По сведениям отдела генетических ресурсов овса, ржи и ячменя ВИР, линия к-28212 получена с участием ярового ячменя из Эфиопии к-17554, а родословная образца к-23787 неизвестна. С помощью праймеров ADUP7, Mlo6 и Mlo10 у образца к-17554 были обнаружены растения, несущие рецессивный аллель mlo11, т.е. эта форма, вероятно, использовалась как донор при отборе линии к-28212 (рис. 3.3.1.2).

–  –  –

Рисунок 3.3.

1.2. ПЦР анализ ДНК единичных растений образца ячменя из

Эфиопии к-17554:

а – с помощью праймеров ADUP7 и Mlo6 (фрагмент длиной ~1200 пн специфичен для аллеля mlo11);

б – с помощью праймеров Mlo6 и Mlo10 (ампликон длиной ~380 пн амплифицируется у генотипов с Mlo локусом дикого типа и ~440 пн – у генотипов, несущих аллель mlo11).

1 – 17 – порядковые номера проанализированных растений.

М – маркер молекулярного веса.

P. Piffanelli с соавторами (2004) провели анализ гаплотипов местных и современных сортов ячменя, а также образцов H.spontaneum, используя различные молекулярные маркеры, в том числе SNP смысловой части локуса Mlo. Эти авторы показали, что все современные европейские сорта, несущие рецессивный аллель mlo11 почти идентичны по исследованным признакам.

Мы сравнили образец к-28212 и изогенную линию – носителя аллеля mlo11.

С помощью праймеров Mlo_F и Mlo_R амплифицировали фрагменты смысловой последовательности локуса. У изогенной линии с аллелем mlo11 (3 растения) и устойчивого дагестанского образца к-28212 (7 растений).

секвенировали фрагмент длиной 530 пн. В последовательностях секвенированных фрагментов обнаружили различия по двум полиморфным сайтам (рис. 3.3.1.3). Были выявлены две замены нуклеотидов (Т-С и С-Т), а также полиморфизм между отдельными растениями, причем некоторые замены ранее в литературе не обсуждались Полученные результаты позволяют предполагать, что гаплотип к-17554 был использован в селекции впервые.

|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....

Ingrid (Y14573) 13415 TTTACTTGTGTTGTAGGCCACGCCCGGCTTGAAGAAATGCTACCACACGCAGATCGGGCTGAGCATCATGAAGGTGGTGGTGGGGCTAGCTCTCCAGTTC 13514 k-30225 (Ingrid_mlo11) 13415.............C

k-30225 (Ingrid_mlo11) 13415.............C

k-30225 (Ingrid_mlo11) 13415.............C

k-28212 13415

k-28212 13415

k-28212 13415

k-28212 13415

k-28212 13415

k-28212 13415

k-28212 13415

|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....

Ingrid (Y14573) 13515 CTCTGCAGCTATATGACCTTCCCCCTCTACGCGCTCGTCACACAGGTAATAAAACCGTCCAGGAAGATGTCTGAGCAATTGCTCTGGAAGAGGATAAACA 13614 k-30225 (Ingrid_mlo11) 13515

k-30225 (Ingrid_mlo11) 13515

k-30225 (Ingrid_mlo11) 13515

k-28212 13515

k-28212 13515

k-28212 13515

k-28212 13515

k-28212 13515

k-28212 13515

k-28212 13515

|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....

Ingrid (Y14573) 13615 TCAGCCTTAATCATCTGTGTGTGCTGGCTTTGTATGCAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCAGACGTCCAAGGCGCTCACCAACT 13714 k-30225 (Ingrid_mlo11) 13615

k-30225 (Ingrid_mlo11) 13615

k-30225 (Ingrid_mlo11) 13615

k-28212 13615

k-28212 13615

k-28212 13615

k-28212 13615

k-28212 13615

k-28212 13615

k-28212 13615

|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....

Ingrid (Y14573) 13715 GGCGGAACACGGCCAAGGAGAAGAAGAAAGTCCGAGACACGGACATGCTGATGGCTCAGATGATCGGCGACGCAACACCGAGCCGAGGCTCGTCGCCGAT 13814 k-30225 (Ingrid_mlo11) 13715

k-30225 (Ingrid_mlo11) 13715

k-30225 (Ingrid_mlo11) 13715

k-28212 13715

k-28212 13715

k-28212 13715

k-28212 13715

k-28212 13715

k-28212 13715

k-28212 13715

|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....

Ingrid (Y14573) 13815 GCCGAGCCGGGGCTCATCACCCGTGCACCTGCTTCACAAGGGCATGGGGCGGTCGGACGACCCCCAGAGCGCGCCCACCTCGCCAAGGACCCAGCAGGAG 13914 k-30225 (Ingrid_mlo11) 13815

k-30225 (Ingrid_mlo11) 13815

k-30225 (Ingrid_mlo11) 13815

k-28212 13815

k-28212 13815

k-28212 13815

k-28212 13815

k-28212 13815

k-28212 13815

k-28212 13815

|....|....|....|....|....|...

Ingrid (Y14573) 13915 GCTAGGGACATGTACCCGGTTGTGGTGGC 13943 k-30225 (Ingrid_mlo11) 13915

k-30225 (Ingrid_mlo11) 13915

k-30225 (Ingrid_mlo11) 13915

k-28212 13915

k-28212 13915

k-28212 13915

k-28212 13915

k-28212 13915

k-28212 13915

k-28212 13915

Рисунок 3.3.

1.3. Выравнивание нуклеотидных последовательностей фрагмента кодирующей области Mlo инбредной линии сорта Ingrid, носителя рецессивного аллеля mlo11 (к-30225) и образца к-28212. Нуклеотидные позиции пронумерованы в соответствии с рефересной последовательностью сорта Ingrid (GenBank: Y14573), представленной в Международном генном банке.

Устойчивость к карликовой ржавчине.

Возбудитель карликовой ржавчины Puccinia hordei G.H. Otth. поражает листья и листовые влагалища. На ДОС ВИР оценили устойчивость к грибу 265 образцов (188 – яровых, 76 – озимых, 1 – двуручка), среди которых преобладали местные формы (236 образцов); сорта и селекционные линии были представлены 29 образцами. Первый учет поражения растений болезнью провели в период колошения, второй – в фазу молочной спелости зерна по шкале от 1 (устойчивость очень низкая) до 9. В 2012–2013 гг.

наблюдали эпифитотию болезни, поражение стандартных сортов по всему посеву составило 1 балл. На жестком инфекционном фоне выделили 4 образца (к-10469, к-10471, к-13233, к-17436), поражение которых составило 7 баллов (табл. 3.3.1.3).

Выделенные формы и 37 линий, несущих идентифицированные гены устойчивости к грибу, высеяли на опытном поле ПЛ ВИР. Образцы ячменя из Дагестана оказались устойчивыми (9 баллов) и к местной популяции гриба (табл. 3.3.1.3). Среди линий с известными Rph-генами устойчивостью (7 баллов, единичные пустулы ржавчины) характеризовались образцы к-18687 Cebada Capa, к-30810 (Н-2210), к-30811 (Н-2211) и к-30812 (Н-2212), несущие ген Rph7 (табл. 3.3.1.4). На выделенных нами образцах симптомы болезни не выявлены.

Таблица 3.3.

1.3. Образцы ячменя, выделившиеся по устойчивости к карликовой ржавчине (ДОС ВИР, 2012–2014 гг.; ПЛ ВИР, 2014 г.)

–  –  –

Таким образом, устойчивые к карликовой ржавчине образцы ячменя из Дагестана могут иметь аллели генов устойчивости, отличающиеся от идентифицированных ранее.

Устойчивость к каменной и пыльной головне.

Семена инокулировали суспензией хламидоспор возбудителя каменной головни (Ustilago hordei (Pers.) Kell. et Swing.) за две недели до посева.

Устойчивость оценивали в период выколашивания по шкале от 0 до 4 (поражено более 40% колосьев). На полях ПЛ ВИР в 2012 и 2014 гг.

исследовали устойчивость к патогену 103 образцов ярового ячменя.

Выделили 1 высокоустойчивый образец (к-23823), все колосья которого не были поражены грибом, слабо (до 20%) поражались 20 изученных форм.

Устойчивость к патогену 81 образца озимого ячменя исследовали в Дербенте на искусственном инфекционном фоне. Выделили 45 образцов, колосья которых не были поражены грибом, 9 образцов проявили себя как устойчивые (поражение до 5%), слабо (до 20%) поражались 24 формы.

На фоне искусственного заражения в ПЛ ВИР изучили устойчивость 88 форм ячменя к возбудителю пыльной головни (Ustilago nuda (Jens) Kell. et Swing). Наиболее устойчив образец к-23830, у которого было поражено 7–9% растений (табл. 3.3.1.5), слабовосприимчивыми оказались 5 образцов.

Поражение грибом восприимчивого контроля составило 100%.

Таблица 3.3.

1.5. Образцы ячменя, выделившиеся по устойчивости к пыльной головне (ПЛ ВИР, 2013–2014 гг.)

–  –  –

3.3.2. Устойчивость ячменя к гемибиотрофным грибам Устойчивость к ринхоспориозу.

Ринхоспориоз, или окаймленная пятнистость листьев (возбудитель – гемибиотрофный гриб Rhynchosporium secalis (Oudem.) J.J. Davis) – болезнь ячменя, широко распространенная во всех основных районах выращивания культуры. В результате лабораторных исследований выделили 44 устойчивых либо гетерогенных по этому признаку образца ячменя, которые оценили на инфекционном фоне в поле. Использовали смешанную споровую суспензию из 58 изолятов, выделенных из 3-х популяций R. secalis. Развитие болезни оценивали по шкале, где поражение до 2-х баллов соответствует реакции устойчивости, 3–5 – восприимчивости. Выделили 7 гетерогенных по устойчивости образцов (табл. 3.3.2.1). Для дальнейшей работы отобрали семена ячменя со здоровых растений. Поражение почти изогенных линий, несущих гены устойчивости Rrs1 – Rrs8, Rrs10 – Rrs15, варьировало от 30% до 70%, на линии с геном Rrs9 симптомы болезни не выявлены. Очевидно, устойчивые компоненты выявленных нами местных форм ячменя защищены генами, отличающимися от Rrs1 – Rrs8 и Rrs10 – Rrs15.

–  –  –

Устойчивость к сетчатой и темно-бурой пятнистостям В лаборатории изучили устойчивость 278 образцов ячменя к возбудителям сетчатой (Pyrenophora teres f. teres Drechsl.) и темно-бурой (Cochliobolus sativus Ito and Kurib.) пятнистостей.

Наиболее высоким уровнем устойчивости (до 4-х баллов) к смеси изолятов из северо-западной (С.-Петербург) популяции C. sativus характеризовались 5 образцов, 17 отнесены к (табл. 3.3.2.2), среднеустойчивым.

В 2014 г. на полях ПЛ ВИР наблюдали естественную эпифитотию темно-бурой пятнистости (поражение восприимчивого контроля – 9 баллов).

Оценили 204 образца ячменя, выделили 17 умеренно устойчивых образцов и 18 – умеренно восприимчивых. Устойчивостью в лабораторных и полевых условиях характеризовались 3 образца: к-15183, к-23822 и к-30084, у которых уровень экспрессии признака в лабораторных опытах выражался баллами 4,0

– 4,5 (табл. 3.3.2.2).

Таблица 3.3.

2.2. Образцы ярового ячменя, устойчивые к северо-западной популяции темно-бурой пятнистости (ПЛ ВИР, 2014 г.)

–  –  –

В лабораторных опытах наиболее высокой устойчивостью к северозападной популяции P. teres f. teres обладали 7 форм (табл. 3.3.2.3), меньший уровень экспрессии признака выявлен у 18 образцов; к популяции гриба из Дагестана (г. Дербент) наиболее устойчивы 6 образцов (табл. 3.3.2.4), 8 образцов характеризовались несколько меньшим уровнем устойчивости. К обеим популяциям гриба устойчивы 3 образца ячменя (табл. 3.3.2.5).

–  –  –

Северо-западная и дагестанская популяции P. teres f. teres различаются по вирулентности и агрессивности (рис. 3.3.2.1). Так, образцы к-21760, кк-21816, к-21807, к-18180 устойчивы к северо-западной и восприимчивы к дагестанской популяции патогена, что свидетельствует о дифференциальном взаимодействии паразита и хозяина. Лишь 3 образца слабо поражаются двумя популяциями гриба. У 32-х образцов наблюдали различную экспрессию устойчивости. Например, образцы к-13232, к-18025, к-18171, к-18180, к-21807, к-25616 обладали высокой устойчивостью при заражении северо-западной популяцией гриба, однако при инокуляции дагестанской популяцией устойчивость была слабо выражена. «Более агрессивной» оказалась дагестанская популяция гриба.

а б Рисунок 3.3.

2.1. Устойчивость коллекционных образцов ячменя из Дагестана к северо-западной (а) и дагестанской (б) популяциям P. teres f. teres:

– высокоустойчивые, – устойчивые, – восприимчивые образцы.

3.3.3. Устойчивость ячменя к насекомым Устойчивость к обыкновенной злаковой тле В результате исследований выделили 40 гетерогенных по устойчивости к обыкновенной злаковой тле образцов ячменя, поврежденность устойчивых компонентов у которых составляла 7-8 баллов. Образец местного ячменя кхарактеризовался несколько более высоким уровнем устойчивости к фитофагу (поврежденность растений 6-7 баллов). Выделившиеся формы могут иметь слабоэкспрессирующиеся гены устойчивости к обыкновенной злаковой тле либо в популяции фитофага присутствуют клоны с различной вирулентностью к изученным образцам ячменя.

Для проверки этого предположения изучили устойчивость шести выделившихся образцов (табл. 3.3.3.1) к 17 клонам тли из краснодарской популяции. Для этого опытные образцы и неустойчивый контроль (по 3-5 зерен) высевали в круговом порядке в сосуды с почвой и накрывали стеклянными изоляторами. В фазу второго листа проростки под изолятором заселяли данным клоном тли и при гибели контроля (сорт Белогорский) оценивали устойчивость по шкале. В силу ограниченного количества имевшихся в нашем распоряжении семян оценили поврежденность двух образцов лишь 11-ю клонами насекомого. Кроме того, 3 наиболее устойчивые формы заселили 20-ю клонами, выделенными из дагестанской (г.

Дербент) популяции тли.

Таблица 3.3.

3.1. Устойчивые к S. graminum образцы ячменя из Дагестана

–  –  –

Оказалось, что верны оба предположения: наблюдали слабоэкспрессирующуюся устойчивость у всех образцов и отчетливо выраженную – у местного ячменя к-13232, причем оба типа устойчивости проявлялись лишь против части клонов тли (табл. 3.3.3.2).

Три первых образца характеризуются устойчивостью примерно к 50% клонов из краснодарской популяции, однако при заселении этим форм дагестанской популяцией насекомого частоты вирулентности существенно меняются:

образец к-13232 обладает устойчивостью к 70% клонов, а к-1067 и к-13992 – лишь к 35% и 22% соответственно.

Таблица 3.3.

3.2. Устойчивость образцов ячменя к клонам S. graminum

–  –  –

Таким образом, результаты исследований показали, что:

слабоэкспрессирующиеся (малые) гены устойчивости против краснодарской популяции S. graminum имеют 17,7% местных форм ячменя из Дагестана;

- высокий уровень устойчивости образца к-13232 против отдельных клонов тли обусловлен главным геном (генами) либо аддитивным действием малых генов;

- выявлено дифференциальное взаимодействие насекомого и малых генов устойчивости растений;

- показано различие краснодарской и дагестанской популяций тли по частотам вирулентности к слабоэкспрессирующимся генам устойчивости растений.

Устойчивость к шведской мухе.

Oscinella frit L. вредит на всходах и в период колошения. В первом случае повреждается стебель, во втором – колос. В Дагестане преобладает второй тип повреждения. При озимом и яровом посеве на естественном фоне изучили устойчивость 222 образцов ячменя к фитофагу. При озимом посеве в 2012-2013 гг. наиболее устойчивыми оказались образцы к-13988, к-1028, кк-13234, к-13991 (табл. 3.3.3.3).

<

–  –  –

Высеянные весной образцы оценили в период кущения – начала выхода в трубку. Наиболее устойчивыми в 2013-2014 гг. оказались образцы к-12214, к-13223, к-13502, к-23830, повреждение которых не превышало 1 балла. У образца к-14893, который высевали только 2014 г., было повреждено 4,4% стеблей (табл. 3.3.3.4).

–  –  –

Поврежденность стеблей восприимчивых образцов достигала 51%.

Устойчивость растений в фазу кущения и в период колошения не связаны (коэффициент корреляции в 2013 г. – 0,0047). Очевидно, устойчивость растений к фитофагу на разных фазах онтогенеза контролируется различными генетическими системами.

3.3.4. Устойчивость ячменя к абиотическим стрессорам

Устойчивость к токсичным ионам алюминия В лаборатории оценили алюмоустойчивость 211 образцов ячменя. Длину зародышевых корней проростков, выращенных в растворе с содержанием 185 мкМ ионов алюминия (pH = 4,0), соотносили с длиной корней растений, выращенных в растворе без добавления солей алюминия (pH = 6,5). Наиболее высокие корневые индексы характерны для 9 образцов ярового ячменя (табл.

3.3.4.1). Для дагестанских ячменей характерен широкий спектр изменчивости по устойчивости, большинство (67%) образцов – среднеустойчивые формы.

Использовали дополнительный тестовый признак – индекс длины ростка и также выявили значительную изменчивость по этому признаку. Образцы ки к-21808 имеют наиболее высокие индексы корня (0,92 и 0,97 соответственно) и ростка (0,97 и 0,98).

–  –  –

Солеустойчивость С использованием рулонного метода, основанного на учете торможения роста корней в условиях солевого (NaCl) стресса, изучили 269 образцов ячменя.

Рассчитывали степень снижения среднего значения длины корешков в растворе соли по отношению к контролю. Образцы разделили на 3 группы: устойчивые (длина корешка 60% по отношению к контролю), среднеустойчивые (40чувствительные ( 40%). В результате оценки 9 образцов оказались устойчивыми по изученному признаку (табл. 3.3.4.2), 233 формы проявили себя как среднеустойчивые, 27 образцов чувствительны к стрессу.

Таблица 3.3.

4.2. Образцы ячменя, устойчивые к солевому стрессу

–  –  –

ЗАКЛЮЧЕНИЕ

Исследование скороспелости и фотопериодической чувствительности дагестанских ячменей продемонстрировало их отчетливую приуроченность к произрастанию в специфических эколого-географических условиях.

Перемещение этой группы ячменей в несвойственные для нее условия северо-запада России приводит к существенной задержке развития растений.

Одной из основных причин этого является характерное для местных форм ячменя из Дагестана аллельное разнообразие генов Ppd-H1 и Ppd-H2, участвующих в контроле продолжительности периода всходы–колошение.

Подавляющее большинство образцов местного ячменя – это носители доминантного аллеля Ppd-H2, который обусловливает более раннее колошение при коротком фотопериоде.

Рисунок. Распределение генотипов, устойчивых к вредным организмам и абиотическим стрессорам, среди групп образцов, выделившихся по результатам молекулярно-генетического анализа.

С помощью молекулярных маркеров нами выявлена генетическая дифференциации дагестанских ячменей; показан полиморфизм по устойчивости к вредным организмам и неблагоприятным эдафическим факторам. Суммируя полученные данные (рисунок), можно отметить, что разнообразие по изученным нами молекулярным маркерам и устойчивость ячменя к неблагоприятным факторам не связаны. В то же время в ряде случаев прослеживается отчетливая связь между местом сбора ячменей и эколого-географической приуроченностью вредного организма или абиотического стрессора. Так, преимущественно в горных районах Дагестана собраны устойчивые к ринхоспориозу образцы (для развития патогена благоприятны прохладные условия), а также формы, толерантные к токсичным ионам алюминия (в горах преобладают кислые почвы).

Использование выделенных нами форм в селекции будет способствовать повышению адаптивного потенциала современных сортов ячменя не только в Дагестане, но и в других регионах Российской Федерации.

ВЫВОДЫ

1. С помощью RAPD- и ISSR-маркеров генотипированы 253 образца дагестанских ячменей из коллекции ВИР, относящиеся к двум подвидам (subsp. vulgare) и (subsp. distichon) и представленные 29 разновидностями.

Методом кластерного анализа изученные формы объединены в 8 групп в зависимости от происхождения и таксономической принадлежности.

2. Оценен диапазон изменчивости дагестанских ячменей по скороспелости и отобран материал, характеризующийся высокой скоростью развития. Показано влияние условий среды на скороспелость местных образцов ячменя из Дагестана. Яровизирующие температуры, короткий день и высокие температуры в период вегетации способствуют скороспелости ячменя.

3. Выявлено 4 источника слабой фотопериодической чувствительности – предполагаемых носителей гена eam8. Молекулярным анализом у растений образца к-14891 обнаружена новая, ранее не описанная мутация в смысловой последовательности гена обусловленная делецией единичного eam8, нуклеотида.

4. Среди местных дагестанских ячменей превалируют носители доминантного аллеля Ppd-H2, который контролирует более ранний переход к колошению при коротком фотопериоде.

5. Дагестанские ячмени полиморфны по устойчивости к облигатным паразитам – возбудителям карликовой ржавчины, мучнистой росы, каменной и пыльной головни. У образца к-28212 с помощью молекулярных маркеров идентифицирован ген mlo11, контролирующий устойчивость ячменя к мучнистой росе.

6. Дагестанские ячмени полиморфны по устойчивости к гемибиотрофным патогенам – возбудителям ринхоспориоза, сетчатой и темно-бурой пятнистостей. Устойчивые к ринхоспориозу компоненты семи гетерогенных образцов ячменя защищены генами, отличающимися от идентифицированных ранее генов Rrs1 – Rrs8 и Rrs10 – Rrs15.

7. Местные ячмени Дагестана дифференцированы по устойчивости к обыкновенной злаковой тле и шведской мухе. Выявлена слабоэкспрессирующаяся и отчетливо выраженная устойчивость к обыкновенной злаковой тле, однако оба типа устойчивости проявляются лишь против части клонов из природных популяций тли. Устойчивость растений к шведской мухе на разных фазах онтогенеза контролируется разными генетическими системами.

8. В результате изучения устойчивости ячменя к абиотическим стрессорам выявлено 9 новых источников устойчивости к действию токсичных ионов алюминия; 9 образцов устойчивы к засолению почвы.

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ

1. Для селекции ячменя в Дагестане и других регионах России предлагаются:

- устойчивый к мучнистой росе образец к-23787, а также образец кзащищенный геном mlo11;

- устойчивые к карликовой ржавчине образцы к-10469, к-10471, к-13233, к-17436;

- устойчивый к каменной головне образец к-23823;

- умеренно устойчивые к темно-бурой пятнистости образцы к-15183, ки к-30084;

- устойчивые к сетчатой пятнистости образцы к-21760, к-23821 и кслабо повреждаемые шведской мухой в фазе колошения образцы кк-13233, к-13234, к-13988, к-13991, а также образцы к-12214, к-13223, к-13502, к-23830, устойчивые к фитофагу в фазе кущения.

2. Для селекции рекомендуются устойчивые к неблагоприятным эдафическим факторам образцы:

- к-13238, к-14149, к-15273, к-15291, к-15292, к-16095, к-18172, к-21807 и к-21808 (устойчивы к токсичным ионам алюминия);

- к-13230, к-13236, к-13497, к-18465, к-21770, к-21775, к-21777, к-26295 и к-26296 (устойчивы к солевому стрессу).

Для селекции ячменя предлагаются 4 источника слабой 3.

фотопериодической чувствительности: к-14891, к-18178, к-21812, к-23785.

–  –  –

«Современные проблемы иммунитета растений к вредным организмам». – СПб., 2008. – С. 80-83.

Анисимова, И.Н. Скрининг генетических ресурсов растений с использованием ДНК-маркеров: основные принципы, выделение ДНК, постановка ПЦР, электрофорез в агарозном геле / И.Н. Анисимова, Н.В.

Алпатьева, Г.И. Тимофеева // Методические указания. – СПб.: ВИР, 2010. – 30 с.

Афанасенко, О.С. Лабораторный метод оценки устойчивости сортообразцов ячменя к возбудителю сетчатого гельминтоспориоза / О.С.

Афанасенко // С.-х. биология. – 1977. – Т. 12. – № 2. – С. 297-299.

Афанасенко, О. С. Наследование устойчивости к возбудителю сетчатой пятнистости у некоторых сортов ячменя / О.С. Афанасенко, И.Ю.

Кушниренко // Генетика. – 1989. – Т. 25, №11. – С. 1994-2000.

Батакова, О.Б. Некоторые итоги по изучению длины вегетационного периода у ячменя в условиях Архангельской области / О.Б. Батакова // Генетические ресурсы ржи, ячменя и овса: Труды по прикл., бот., ген. и сел. – СПб.: ВИР, 2009. – Т.165. – С. 169-173.

Баташева, Б.А. Перспективы повышения продуктивности ячменя в Дагестане на основе изучения генофонда / Б.А. Баташева // Дис. … доктора биол. наук. СПб: ВИР, 2012. – 310 с.

Баташева, Б.А. Внутривидовое разнообразие ячменя культурного (H. vulgare L.) по устойчивости к шведской мухе (Oscinella pusilla Meig.) / Баташева Б.А., Альдеров А.А. – Махачкала, 2004. – 40 с.

Баташева, Б.А. Вредоносность шведской мухи (Oscinella frit L.) в южноплоскостной зоне Дагестана / Б.А. Баташева, Е.Е. Радченко, О.Н. Ковалева, И.А. Звейнек, Р.А. Абдуллаев // Проблемы развития АПК региона. – 2013. – № 4. – С. 15-18.

Баташева, Б.А. Озимый ячмень в условиях Южного Дагестана / Б.А.

Баташева, И.А. Терентьева, И.А. Звейнек, А.А. Альдеров, У.К. Куркиев, Г.М.

Богданова // Каталог мировой коллекции ВИР. – Вып. 798. – 2010. – 65 с.

Брискина, О.С. Скрининг коллекции ячменя на устойчивость к ринхоспориозу / О.С. Брискина, И.А. Терентьева // Вестник защиты растений. – 2000. – № 1. – С. 105-106.

Будницкая, Е.В. Современные представления о биосинтезе и физиологической роли каротиноидов / Е.В. Будницкая // Изв. АН СССР. – №4. – 1952. – С. 80-82.

Вавилов, Н.И. Мировые ресурсы зерновых культур и льна. Опыт агроэкологического обозрения важнейших полевых культур / Н.И. Вавилов // М.; Л.: Изд-во АН СССР, – 1957. – 462 с.

Вавилов, Н.И. Проблемы иммунитета культурных растений / Н.И.

Вавилов // М-Л.: Наука, 1964. – Т. 4. – 516 с.

Вилкова, Н.А. Некоторые морфофизиологические особенности шведской мухи Oscinella frit L. в связи различным кормовым режимом / Н.А.

Вилкова //Тр. ВИЗР. – № 9. – 1969. – С. 110-111.

Гаркавый, П.Ф. Методические указания по изучению иммунитета ячменя к пыльной головне и селекции устойчивых сортов / П.Ф. Гаркавый, Е.К. Кирдогло // Одесса. – 1980. – 28 с.

Груздева, Е.В. Ячмень. Лабораторная оценка образцов ячменя на кислотоустойчивость (Al3+, Mn2+) / Е.В. Груздева, О.В. Яковлева, И.А.

Косарева, А.М. Капешинский, И.А. Терентьева, О.Н. Ковалева // Каталог мировой коллекции ВИР, – вып. 701. – СПб.: ВИР, 1999. – 28 с.

Давыдова, Г.В. Ячмень. Характеристика селекционных и местных сортов на солеустойчивость./ Г.В. Давыдова, В.С. Коваль, М.В. Лукьянова // Каталог мировой коллекции ВИР, – вып. 605. – Л: ВИР, 1991. –34 с.

Дорохов, Д.Б. Быстрая и экономичная технология RAPD анализа растительных геномов / Д.Б. Дорохов, Э. Клоке // Генетика. 1997. – Т. 33. – № 4. – С. 443-450.

Заушинцена, А.В. Генетические источники для реализации основных направлений селекции ячменя в Сибири / А.В. Заушинцена // Генетические ресурсы ржи, ячменя и овса: Труды по прикл., бот., ген. и сел. – СПб.: ВИР, 2009. – Т.165. – С. 101-105.

Захаренко, В.А. Карты распространения вредных организмов, патотипов, генов вирулентности возбудителей болезней, фитофагов, энтомопатогенов на территории Российской Федерации / В.А. Захаренко, А.В. Овсянкина, С.С. Санин, Т.З. Ибрагимов, О.М. Рулева, Е.Д. Коваленко, Т.М. Коломиец, А.И. Жемчужина, А.А. Санина // М.: Россельхозакадемия, 2003. – 64 с.

Злотина, М.М. Использование аллель-специфичных маркеров генов Ppd и Vrn для прогнозирования продолжительности вегетационного периода сортов ячменя / М.М. Злотина, О.Н. Ковалева, И.Г. Лоскутов, Е.К. Потокина // Вавиловский журнал генетики и селекции. – 2013. – Т. 17. – № 1. – С. 50Илларионов, А.И. Злаковые мухи: распространение, вредоносность и приемы ограничения их численности / А.И. Илларионов, Р.А. Самсонов // Вестник Воронежского государственного аграрного университета – 2010. – №1 (24). – С.10-26.

Йонева, Ж. Биометрические показатели и осмотический потенциал органов растений в условиях хлоридного засоления / Ж. Йонева, А.Е.

Петров-Спиридонов // Известия ТСХА. – 1985. – Вып. 3. – С. 120-125.

Кгаевская, О.С. Выявление у сортов ячменя признаков коррелирующих с устойчивостью к шведской мухе / О.С. Кгаевская, А.В. Заговора // Иммунитет сельскохозяйственных растений к болезням и вредителям. – М., 1975. – С.353-358.

Климашевский, Э.Л. Генетический аспект минерального питания растений / Э.Л. Климашевский // М.: Агропромиздат, 1991. – 415 с.

Климашевский, Э.Л. Физиолого-генетические основы агрохимической эффективности растений / // В кн.: Физиологические основы селекции растений. СПб., ВИР, 1995. – Т. 2, ч.1. – С. 97-157.

Климашевский, Э. Л. О природе генотипической специфики устойчивости растений к А1 / Э.Л. Климашевский, Ю.А. Макарова, Р.И.

Сибирова // Докл. ВАСХНИЛ. – 1978б. – №8. – С.2-5.

Коваль, В.С. Закономерности изменчивости и наследования солеустойчивости ячменя / В.С. Коваль // Автореф. дис. … канд. биол. наук.

Новосибирск: ИЦИГ, 1993. – 18 с.

Коновалова, Г.С. Ринхоспориоз. В кн.: Изучение генетических ресурсов зерновых культур по устойчивости к вредным организмам/ Г.С. Коновалова // Методическое пособие. М.: Россельхозакадемия, 2008. – С. 129-135.

Коновалова, Г.С. Источники устойчивости ячменя из Юго-Восточной Азии к возбудителю ринхоспориоза (Rhynchosporium secalis) ((Oud.)) / Г.С.

Коновалова, О.Н. Соболева // Микология и фитопатология. – 2010. – Т. 44. – Вып. 3. – С. 248-254.

Косарева, И.А. Определение кислотоустойчивости зерновых культур.

Методические указания / И.А. Косарева, Г.В. Давыдова, Е.В. Семенова // СПб.: ВИР. – 1995. – 24 с.

Кривченко, В.И. Устойчивость зерновых колосовых к возбудителям головневых болезней / В.И. Кривченко // М.: Колос. – 1984. – 304 с.

Кривченко, В.И. Мучнистая роса. В кн.: Изучение генетических ресурсов зерновых культур по устойчивости к вредным организмам / В.И.

Кривченко, Т.В. Лебедева, Х.О. Пеуша // Методическое пособие. М.:

Россельхозакадемия, 2008. – С. 86-105.

Кривченко, В.И. Селекционная ценность генов устойчивости ячменя к пыльной головне / В.И. Кривченко, А.П. Хохлова // Бюлл. ВНИИ растениеводства «Рожь и зернофуражные культуры. – Л., 1980. – Вып. 104. – С. 72-75.

Кривченко, В.И. Головневые болезни зерновых культур. В кн.: Изучение генетических ресурсов зерновых культур по устойчивости к вредным организмам / В.И. Кривченко, А.П. Хохлова //. Методическое пособие.

М.:

Россельхозакадемия, 2008. – С. 32-85.

Лапина, Л.П. Локализация хлора у гликофитов и галофитов при засолении / Л.П. Лапина, Т.В. Соколова, Б.П. Строгонов // Физиология растений. – 1980. –Т. 27. – Вып. 2. – С. 278-286.

Лебедева, Л.В. Внутривидовое разнообразие фитопатогенного гриба Rhynchosporitim secalis (Oud.) J.J. Davis / Л.В. Лебедева // Дис. … канд. биол.

наук. – СПб.: ВИЗР. – 2005. – 142 с.

Лебедева, Л.В. Анализ российской и чешской популяций возбудителя окаймленной пятнистости ячменя Rhynchosporium secalis по признаку вирулентности / Л.В. Лебедева, Л. Тваружек, Г.С. Коновалова // Микология и фитопатология. – 2006. – Т. 40. – № 4. – С. 337-342.

Лоскутов, И.Г. Методические указания по изучению мировой коллекции ячменя и овса/ И.Г. Лоскутов, О.Н. Ковалева, Е.В. Блинова // СПб.: ВИР, 2012. – 63 с.

Лукьянова, М.В. Агробиологическое изучение коллекции овса и ячменя в целях использования на зеленый корм / М.В. Лукьянова // Автореф. дисс.

… канд. биол. наук. – Л.: ВИР. – 1958. – 13 с.

Лукьянова, М.В. Культурная флора СССР. Ячмень. / М.В. Лукьянова,

А.Я. Трофимовская, Г.Н. Гудкова, И.А. Терентьева, Н.П. Ярош // Л:

Агропромиздат. 1990. – Т. 2. – Ч. 2. – 423 с.

Мещеряков, А.И. Влияние кислотности и алюминия на рост растений / А.И. Мещеряков // Труды ВИУА. – 1937. – Вып. 16. – С. 166-182.

Мусааджиева, Б.А. Устойчивость ячменя к шведской мухе в условиях Дагестана / Б.А. Мусааджиева // Науч.-техн. бюл. ВИР. –1988.– Т. 185. – С.

27-30.

Нарчук, Э.П. Семейство Сhloropidае – злаковые мухи / Э.П. Нарчук // В кн.: Насекомые и клещи – вредители сельскохозяйственных культур.

Перепончатокрылые и двукрылые. – Л., 1981. – Т. IV. – С. 161-187.

Небольсина, А.Н., ред. Эколого-экономические основы и рекомендации по известкованию, адаптированные к конкретным почвенным условиям / Под ред. А.Н. Небольсина, В.Г. Сычева // М.: Изд-во ЦИНАО, 2000. – 80 с

Павлов, И.Ф. Защита полевых культур от вредителей / И.Ф. Павлов // М.:

Россельхоиздат, 1983. – 224 с.

Поморцев, А.А. Хромосомная локализация гена устойчивости к пыльной головне Run 8 у ячменя / А.А. Поморцев, Н.А. Терещенко, Е.В. Лялина, М.В.

Офицеров, В.А. Пухальский // Генетика. – 1998. –Т. 34.– № 11. – С. 1513Поморцев, А.А. Хромосомная локализация гена устойчивости к пыльной головне у ячменя / А.А. Поморцев, Н.А. Терещенко, М.В. Офицеров, В.А.

Пухальский // Генетика. 1999. – Т. 35. – № 7. – С. 1016-1018.

Радченко, Е.Е. Злаковые тли. В кн.: Изучение генетических ресурсов зерновых культур по устойчивости к вредным организмам / Е.Е. Радченко // Методическое пособие. М.: Россельхозакадемия, 2008. – С. 214-257.

Радченко, Е.Е. Устойчивость образцов ячменя из Восточной и Южной Азии к обыкновенной злаковой тле / Е.Е. Радченко, Т.Л. Кузнецова, И.А.

Звейнек, О.Н. Ковалева // Доклады РАСХН. – 2014. – № 1. – С. 34-37.

Ригин, Б.В., Яковлева О.В. Генетический анализ устойчивости ячменя к токсичным ионам алюминия / Б.В.Ригин, О.В. Яковлева // Генетика. – 2006.

– Т. 42. – № 3. – С. 301-305.

Родина, Н.А. Оценка сортов ячменя на устойчивость к кислым почвам и алюминию / Н.А. Родина // Селекция зерновых культур на устойчивость к болезням и неблагоприятным факторам среды в Волго-Вятском регионе. Сб.

тр. НИИСХ Северо-Востока. – Киров, 1986. – С. 47-55.

Рочев, М.В. Устойчивость сортообразцов ячменя к Bipolaris sorokiniana (Sacc.) Shoem. в условиях среднего Урала / М.В. Рочев, М.М. Левитин // Сибирский вестн. с.-х. науки. – 1986. – №6. – С. 18-21.

Рубин, Б.А. Курс физиологии растений / Рубин Б.А. // М.: Высшая школа. – 1971. – 672 с.

Семенова, А.Г. Устойчивость ячменя к овсяной шведской мухе / А.Г. Семенова// Фитосанитарное оздоровление экосистем. Материалы Второго Всероссийского съезда по защите растений. – СПб, 2005. – Т. 1. – С.

557-559.

Семенова, А.Г. Злаковые мухи. В кн.: Изучение генетических ресурсов зерновых культур по устойчивости к вредным организмам. / А.Г. Семенова // Методическое пособие. М.: Россельхозакадемия, 2008. – С. 196-213.

Семенова, А.Г. Факторы устойчивости ячменя к овсяной шведской мухе / А.Г. Семенова, Л.И. Нефедова // Вестник защиты растений. 2005. № 1 – С.

38-44.

Семенова, А.Г. Наследование устойчивости к шведским мухам у ячменя / А.Г. Семенова, И.Г Одинцова // Сб. науч. тр. по прикл. ботанике, генетике и селекции. 1993. Т. 147. – С. 61-66.

Синельников, Е.А. Отложение окиси кремния как фактор устойчивости ячменя к шведской мухе. Тез. докл. Всесоюз. науч.-техн. конф. "Пробл.

селекции зерн. культур на устойчивость к болезням и неблагоприят.

условиям среды" / Е.А. Синельников, И.Д. Шапиро. М.: 1990. – С. 126-127.

Соболева, О.Н. Генетическое разнообразие местных форм ячменя по устойчивости к ринхоспориозу / О.Н. Соболева // Автореф. дис. … канд.

биол. наук. СПб: ВИР. – 2011. – 20 с.

Соловьева, Н.Н. Генетический контроль устойчивости коллекционных образцов и сомаклональных вариантов ярового ячменя к тёмно-бурой листовой пятнистости и обыкновенной корневой гнили: автореф. дис. … канд. биол. наук / Соловьева Н.Н. – СПб., 2004. – 20 с.

Строгонов, Б.П. Структура и функции клеток растений при засолении / Б.П. Строгонов, В.В. Кабанов, Н.И. Шевякова // М. 1970. – 318 с.

Трофимовская, А.Я. Ячмень / А.Я. Трофимовская // М.: Колос, 1972. – 296 с.

Трофимовская, А. Международный классификатор СЭВ рода Hordeum L. (подрод Hordeum) / А. Трофимовская, М. Лукьянова, В. Корнейчук, Н.

Ильина, Н. Ярош, Я. Лекеш, И. Бареш, А. Форал, В. Одегнал, Ф. Ружичка, М.

Бобек // Л.: ВИР. – 1983. – 56 с.

Тырышкин Л.Г. Генетический контроль эффективной устойчивости коллекционных образцов ячменя Hordeum vulgare L. к карликовой ржавчине / Л.Г. Тырышкин // Генетика. – 2009. – Т. 45. – № 3. – С. 427-429.

Тырышкин, Л.Г. Наследование устойчивости к листовой пятнистости, вызываемой Bipolaris sorokiniana, сорта мягкой пшеницы 181-5 / Л.Г.

Тырышкин, Л.А. Михайлова // Труды по прикл. бот., ген. и сел. 1993. – Т.

147. – С. 35-39.

Тырышкин, Л.Г. Генетика устойчивости пшеницы и ячменя к тёмнобурой листовой пятнистости / Л.Г. Тырышкин, Д.Н. Шевченко // Генетика. – 1994. – T. 30. – C. 160.

Удовенко, Г.В. Солеустойчивость культурных растений и ее физиологическая природа / Г.В. Удовенко// Тр. по прикл. бот., ген. и сел. – 1975а. – Т. 54. – Вып. 1. – С. 173-187.

Удовенко, Г.В. Исследование физиологии устойчивости растений к неблагоприятным условиям среды / Г.В. Удовенко // Тр. по прикл. бот., ген.

и сел. – 1975б. – Т. 56. – Вып. 1. – С. 154-161.

Удовенко, Г.В. Определение в раннем возрасте солеустойчивости зерновых злаков по комплексу ростовых параметров / Г.В. Удовенко, А.М.

Волкова // Методические указания. – СПб.: ВИР, 1993. – 15 с.

Хасанов, Б.А. Несовершенные грибы как возбудители основных заболеваний злаков в Средней Азии и Казахстане: автореф. дис. … д-ра биол.

наук / Хасанов Б.А. – М., 1992. – 44 с.

Хохлова, А.П. Гены устойчивости против карликовой ржавчины ячменя / А.П. Хохлова // Труды по прикл. бот., ген. и сел. – 1982. – Т.71. – Вып.3. – С. 63-68.

Хохлова, А.П. Устойчивость ячменя к пыльной головне и состав генов, контролирующих этот признак / А.П. Хохлова // Дис. … канд. с.-х. наук.

Л.:

ВИР. – 1990. – 151 с.

Чесноков, П.Г. Устойчивость зерновых культур к насекомым / П.Г.

Чесноков. – М.: Советская наука, 1956. – 307 с.

Шапиро, И.Д. Шведские мухи / И.Д. Шапиро // М.: Агропромиздат,

1989. 60 с.

Яковлева, О.В. Устойчивость культурного и дикого ячменя к действию токсичных ионов алюминия / О.В. Яковлева, А.М. Капешинский, О.Н.

Ковалева // Труды по прикл. бот., ген. и сел. – 2009. – Т. 165. – С. 51-53.

Abbot, D.C. Genes for scald resistance from wild barley (Hordeum vulgare ssp. spontaneum) and their linkage to isozyme markers / D.C. Abbot, A.H.D.

Brown, J.J. Burdon // Euphytica. – 1992. – V. 61. – № 3. – P. 225-231.

Abbot, D.C. Identification of RFLPs flanking a scald resistance gene on barley chromosome 6 / D.C. Abbot, E.S. Lagudah, A.H.D. Brown // J. Hered. – 1995. – V. 86. – P. 152-154.

Andrews, I.E. Inheritance of reaction to loose smut, Ustilago nuda, and to stem rust Puccinia graminis, in barley / I.E. Andrews // Can. Jour. Agr. Sci. – 1956. – V. 36. – № 5. – P. 356-370.

Anstead, J.A. Over-summering and biotypic diversity of Schizaphis graminum (Homoptera: Aphididae) populations on noncultivated grass hosts / J.A.

Anstead, J.D. Burd, K.A. Shufran // Environ. Entomol. – 2003. – V. 32. – № 3. – P. 662-667.

Arabi, M.I.E. Inheritance of partial resistance to net blotch in barley / M.I.E.

Arabi, A. Sarrafi, G. Barrault, L. Albertini // Plant Breed. – 1990. – V. 105. – P.

150-155.

Argandoa, V.H. Ethylene production and peroxidase activity in aphidinfested barley / V.H. Argandoa, M. Chaman, L. Cardemil, O. Muoz, G.E.

Ziga, L.J. Corcuera // J. Chem. Ecol. – 2001. – V. 27. – № 1. – P. 53-68.

Atkins, I.M. Reaction of small-grain varieties to green bug attack / I.M.

Atkins, R.G. Dahms // USDA. – 1945. – Techn.bull. – № 901. – 30 p.

Baker, R.J. The inheritance of scald resistance in barley / R.J. Baker, E.N.

Larter // Can. J. Genet. Cytol. – 1963. – V. 5. – P. 445-449.

Barcelo, J. Ch. Aluminium phytotoxicity / J. Ch. Barcelo, M.D.

Poschenrieder, B.G. Vazquez // In: C. Rodriguez-Barnieco (Ed) Fertilizers and Environment, Kluwer Academic Publishers. – 1996. – P. 405-411.

Beer, W.W. Leaf blotch of barley (Rhynchosporium secalis) / W.W. Beer // Microbiol Res. – 1991. – V. 146. – P. 339-358.

Bennet, R.J. Aluminium toxicity and regeneration of the root cap. Preliminary evidence for a Golgi apparatus-derived morphogen in the primary root of Zea mays / R.J. Bennet, C.M. Breen, V. Bandy // South. Afr. J. Bot. – 1985c. – V. 51. – P.

363-370.

Bilgic, H. Differential expression of seedling and adult plant resistance to spot blotch in different genetic backgrounds of barley / H. Bilgic, B. J. Steffenson, P.

Hayes // Theor. Appl. Gen. – 2005. – V. 111. – P. 1238-1250.

Bilgic, H. Molecular mapping of loci conferring resistance to different pathotypes of the spot blotch pathogen in barley / H. Bilgic, B.J. Steffenson, P.M.

Hayes // Phytopathology. – 2006. – V. 96, № 7. – P. 699-708.

Bjrnstad, A. Resistance to scald (Rhynchosporium secalis) in barley (Hordeum vulgare L.) studied by near-isogenic lines. I. Markers and differentials isolates/ A. Bjrnstad, V. Patil, A. Tekauz, AG. Mary, H. Skinnes, A. Jensen, H.

Magnus, J. MacKey // Phytopathology. – 2002. – V. 92. – № 7. – P. 710-720.

Bockelman, H. E. Trisomic analysis of genes for resistance to scald and net blotch in several barley cultivars / H.E. Bockelman, E.L. Sharp, R.F Eslik // Canad. J. Bot. – 1977. – V. 55, № 15. – P. 2142-2148.

Bonman J.M. Disease and Insect Resistance in Cultivated Barley Accessions from the USDA National Small Grains Collection / J.M. Bonman, H.E.

Bockelman, L.F. Jackson, B.J. Steffenson // Crop Sci. – 2005. – V. 45. – № 4. – P.

1271-1280.

Borovkova, I.G. Chromosomal location and genetic relationship of leaf rust resistance genes Rph9 and Rph12 in barley / I.G. Borovkova, Y. Jin, B.J.

Steffenson // Phytopathology. – 1998. – V. 88. – № 1. – P. 76-80.

Bovill, J Mapping spot blotch resistance genes in four barley populations / J.

Bovill, A. Lehmensiek, M.W. Sutherland, G.J. Platz, T. Usher, J. Franckowiak, E.

Mace // Molec. Breed. – 2010. – V. 26. – P. 653-666.

Brunner, S. Molecular mapping of Rph7.g leaf rust resistance gene in barley (Hordeum vulgare L.) / S. Brunner, B. Keller, C. Feuillet // Theor. Appl. Genet. – 2000. – V. 101. – P. 783-788.

Bryner, C.S. Inheritance of scald resistance in barley / C.S. Bryner // Ph D.

thesis. Pennsylvania State University, University Park. – 1957.

Bschges, R. The barley mlo gene: A novel control element of plant pathogen resistance / R. Bschges, K. Hollricher, R. Panstruga, G. Simons, M. Wolter, A.

Frijters, R. Van Daelen, T. Van der Lee, P. Diergaarde, J. Groenendijk, S. Topsch, P. Vos, F. Salamini, P. Schulze-Lefert //Cell. – 1997. – V.88. – P. 695-705.

Casao, M.C. Adaptation of barley to mild winters: а role for PPDH2 / M.C.

Casao, I. Karsai, E. Igartua, M.P. Gracia, O. Veisz, A.M. Casas // BMC Plant Biology. – 2011. – V. 11. – Art. 164.

Casaretto, J.A. Proteinase inhibitor accumulation in aphid-infested barley leaves / J.A. Casaretto, L.J. Corcuera // Phytochemistry. – 1998. – V. 49. – № 8. – P. 2279-2286.

Chelkowski, J. Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers / J. Chelkowski, M. Tyrka, A. Sobkiewicz // Appl. Genet. – 2003. – V. 44. – № 3. – P. 291-309.

Cherewiск, W.J. Inheritance of resistance to covered and false loose smut in the barley varieties Pannier and Excelsior / W.J. Cherewiск, K.W. Buchannon // Canad. J. Genet. Cytol. – 1969. – V. 11. – № 2. – P. 250-253.

Clarkson, D.T. Effect of aluminium on the uptake and metabolism of phosphorus by barley seedlings / D.T. Clarkson // Plant Physiol. – 1966. – V. 41. – №1. – P. 165-172.

Clarkson, D.T. Interaction between Al and phosphorus on root surface and cell wall material / D.T. Clarkson // Plant and Soil. – 1967. – V. 22. – №3. – P.

347-356.

Cockram, J. PCR-based markers diagnostic for spring and winter seasonal growth habit in barley / J. Cockram, C. Norris, D.M. O'Sullivan // Crop Sci. – 2009. –V. 49. – № 2. – P. 403-410.

Corcuera, L.J. Effects of indole alkaloids from Gramineae on aphids / L.J.

Corcuera // Phytochemistry. – 1984. – V. 23. – № 3. – P. 539-541.

Dice, L.R. Measures of the amount of ecological association between species / L.R. Dice // Ecology. – 1945. – V. 26. – № 3. – P. 297-302.

Domingo, J.L. Citric, malic and succinic acids as alternatives to defferoxamine in aluminum toxicity / J.L. Domingo, M. Gomez, J.M. Llobet, J.

Gorbella // Clin. Toxicol. – 1988. – V. 26. – P. 67-79.

Dreiseitl, A. Frequency of powdery mildew resistances in spring barley cultivars in Czech variety trials / A. Dreiseitl // Plant Protection Science. – 2012. – V. 48, – P.17-20.

Dreiseitl, A. Postulation of leaf rust resistance genes in Czech and Slovak barley cultivars and breeding lines / A. Dreiseitl, B.J. Steffenson // Plant Breed. – 2000. – V. 119. – P. 211-214.

Dyck, P.L. Inheritance of resistance in barley to several physiologic races of the scald fungus / P.L. Dyck, C.W. Shaller // Can. J. Genet. Cytol. – 1961. – V. 3.

– P. 153-164.

Echart, C.L. Aluminum tolerance in barley: methods for screening and genetic analysis / C.L. Echart, J.F. Barbosa-Neto, D.F. Garvin, S. Cavalli-Molina // Euphytica. – 2002. – V. 126. – № 3. – P. 309-313.

Ellis, R.P. Phenotype/genotype associations for yield and salt tolerance in a barley mapping population segregating for two dwarfing genes / R.P. Ellis, B.P.

Forster, D.C. Gordon, L.L. Handley, R.P. Keith, P. Lawrence, R. Meyer, W.

Powell, D. Robinson, C.M. Scrimgeour, G. Young, W.T. Thomas // J. Exp. Bot. – 2002. – V. 53. – № 371. – P. 1163–1176.

Emebiri, L.C. Disease resistance genes in a doubled haploid population of two-rowed barley segregating for malting quality attributes / L.C. Emebiri, G.

Platz, D.B. Moody // Austral. J. Agric. Res. – 2005. – V. 56. – P. 49-56.

Farrell, J.A. Resistance to the rose-grain aphid (Metopolophium dirhodum (Walk.)) in non-glaucous spring barley / J.A. Farrell, M.W. Stufkens // N. Z. J.

Exp. Agr. – 1988. – V. 16. – № 3. – P. 305-306.

Faure, S. The FLOWERING LOCUS T-like gene family in barley (Hordeum vulgare) / S. Faure, J. Higgins, A. Turner, D.A. Laurie // Genetics. – 2007. – V.

176. – № 1. – P. 599-609.

Faure, S. Mutation at the circadian clock gene EARLY MATURITY 8 adapts domesticated barley (Hordeum vulgare) to short growing seasons / S. Faure, A.S.

Turner, D. Gruszka, V. Christodoulou, S.J. Davis, M. Von Korff, D.A. Laurie // Proc. Natl. Acad. Sci. – 2012. – V. 109. – № 21. – P. 8328-8333.

Fetch, Jr.T.G. Worldwide virulence of Puccinia hordei on barley / Jr.T.G.

Fetch, B.J. Steffenson, Y. Jin // Phytopathology. – 1998. – V. 88. – S28.

Fetch, T.G.Jr. Rating scales for assessing infection responses of barley infected with Cochliobolus sativus / T.G.Jr. Fetch, B.J. Steffenson // Plant Dis. – 1999. – V. 83. – № 3. – P. 213-217.

Fetch, T. G. Jr. Spring barley accessions with dual spot blotch and net blotch resistance / T.G.Jr. Fetch, B.J. Steffenson, H.E. Bockelman, D.M. Wesenberg // Canad. J. Plant Pathol. – 2008. – V. 30. – № 4. – P. 534-542.

Forslund, K. Aphid infestation induces PR-proteins differently in barley susceptible or resistant to the birdcherry-oat aphid (Rhopalosiphum padi) / K.

Forslund, J. Pettersson, T. Bryngelsson, L. Jonsson // Phys. Plantarum. – 2000. – V. 110. – № 4. – P. 496-502.

Foy, C.D. Differential Al tolerance of two wheat varieties associated with plant-induced pH chenges araund their roots / C.D. Foy // Proc. Soil Sci. Soc.

Amer. – 1965. – V. 29. – № 1. – P. 64.

Foy, C.D., Fleming A.L. Aluminum tolerances of two wheat genotypes related to nitrate reductase activities / C.D. Foy // J. Plant Nutr. – 1982. – V. 5. – P.

1313-1333.

Foy, C.D., Characterization of differential aluminum tolerance among varieties of wheat and barley / C.D. Foy, A.L. Fleming, G.R. Bums, W.H.

Arminger // Soil Sci. Soc. Am. Proc. – 1965. – V. 31. – P. 513-521.

Franckowiak, J.D. Recommended allele symbols for leaf rust resistance genes in barley / J.D. Franckowiak, Y. Jin, B.J. Steffenson // Barley Genet. Newslet. – 1997. – V. 27. – P. 36-44.

Franckowiak, J.D. Descriptions of barley genetics stocks for 2011 / J.D.

Franckowiak, U. Lundqvist // Barley Genetics Newsletter. – 2011. – V. 41. – P.

54-202.

Gardenhire, J.H. Inheritance and linkage studies on greenbug resistance in barley (Hordeum vulgare L.) / J.H. Gardenhire // Crop Sci. – 1965. – V. 5. – № 1.

– P. 28-29.

Gardenhire, J.H. Inheritance of greenbug resistance in barley / J.H.

Gardenhire, H.L. Chada // Crop Sci. – 1961. – V. 1. – P. 349-352.

Gardenhire, J.H. Trisomic analysis of greenbug resistance in barley, Hordeum vulgare L. / J.H. Gardenhire, N.A. Tuleen, K.W. Stewart // Crop Sci. 1973. – V.

13. – № 6. – P. 684-685.

Garvin, D.F. Inheritance and chromosome locations of scald-resistance genes derived from Iranian and Turkish wild barleys / D.F. Garvin, A.H.D. Brown, J.J.

Burdon // Theor. Appl. Genet. – 1997. – V. 94. – P. 1086-1091.

Garvin D.F., Brown A.H.D., Raman H., Read B.J. Genetic mapping of the barley Rrs14 scald resistance gene with RFLP, isozyme and seed storage protein markers / D.F. Garvin, A.H.D. Brown, H. Raman, B.J. Read // Plant Breed. – 2000. – V. 119. – № 3. – P. 193-196.

Gai, О. Comparative study of effect of Cu on superoxide dismutase, peroxidase and glutathione-peroxidase activity and lipid peroxidation in young plants of wheat and maize / О. Gai, R. Kastori, M. Popovi et al. // I Regional Symposium: Chemistry and the Environment, Vrnjacka Banja. – 1995. – P. 559Genger, R.K. Development of SCAR markers linked to a scald resistance gene derived from wild barley / R.K. Genger, A.H.D. Brown, W. Knogge, K.

Nesbitt, J.J. Burdon // Euphytica. – 2003a. – V. 134. – № 2. – P. 149-159.

Genger, R.K. A novel barley scald resistance gene: genetic mapping of the Rrs 15 scald resistance gene derived from wild barley, Hordeum vulgare ssp.

spontaneum / R.K. Genger, K. Nesbitt, A.H.D. Brown, D.C. Abbot, J.J. Burdon // Plant Breed. – 2005. –V. 124. – № 2. – P. 137-141.

Genger, R.K. Leaf scald resistance genes in Hordeum vulgare and Hordeum vulgare ssp. spontaneum: parallels between cultivated and wild barley / R.K.

Genger, K.J. Williams, H. Raman, B.J. Read, H. Wallwork, J.J. Burdon, A.H.D.

Brown // Austr. J. Agric. Res. – 2003b. – V. 54. – P. 1335-1342.

Graner, A. RFLP mapping of a gene in barley conferring resistance to net blotch (Pyrenophora teres) / A. Graner, B. Foroughi-Wehr, A. Tekauz // Euphytica. – 1996. – V. 91. – P. 229-234.

Greenway, H. Plant response to saline substrates. I. Growth and ion uptake of several varieties of Hordeum during and after sodium chloride treatment / H.

Greenway // Austr. J. Biol. Sci. – 1962. – V. 15. – № 1. – P. 16-38.

Greenway, H. Plant response to saline substrates. VII. Growth and ion uptake throughout plant development in two varieties of Hordeum vulgare / H. Greenway // Austr. J. Biol. Sci. – 1965. – V. 18. – № 4. – P. 763-779.

Grewal, T.S. Identification of resistance genes to barley covered smut and mapping of the Ruh1 gene using Ustilago hordei strains with defined avirulence genes / T.S. Grewal, B.G. Rossnagel, G. Bakkeren, G.J. Scoles // Can. J. Plant Pathol. – 2008. – V. 30. – № 2. – P. 277-284.

Grewal, T. S. Mapping quantative trait loci associated with barley net blotch resistance / T.S. Grewal, B.G. Rossnagel, C.J. Pozniak, G.J. Scoles // Appl. Gen. – 2008. – V. 116. – P. 529-539.

Grewal, T.S. Mapping quantitative trait loci associated with spot blotch and net blotch resistance in a doubled-haploid barley population / T.S. Grewal, B.G.

Rossnagel, G.J Scoles // Molec. Breed. – 2012. – V. 30, № 1. – P. 267-279.

Grnnerd, S. Genetic analysis of resistance to barley scald (Rhynchosporium secalis) in the Ethiopian line "Abyssinian" (CI668) / S.

Grnnerd, A.G. Mary, J. MacKey, A. Tekauz, G.A. Penner // Euphytica. – 2002.

– V. 126. – № 2. – P. 235-250.

Grn, S. Evolution of the indole alkaloid biosynthesis in the genus Hordeum.

Distribution of gramine and DIBOA and isolation of the benzoxazinoid biosynthesis genes from Hordeum lechleri / S. Grn, M. Frey, A. Gierl // Phytochemistry. – 2005. – V. 66. – № 11. – P. 1264-1272.

Habgood, R.M.The inheritance of resistance to Rhynchosporium secalis (Oud.) J. J. Davis in barley / R.M. Habgood, J.D. Hayes // Heredity. – 1971. – V.

27. – P. 25-37.

Hanemann, A. Fine mapping, physical mapping and development of diagnostic markers for the Rrs2 scald resistance gene in barley / A. Hanemann, G.F. Schweizer, R. Cossu, T. Wicker, M.S. Rder // Theor. Appl. Genet. – 2009. – V. 119. – № 8. – P. 1507-1522.

Hickey, L.H. Mapping Rph20: a gene conferring adult plant resistance to Puccinia hordei in barley / L.H. Hickey, W. Lawson, G.J. Platz, M. Dieters, V.N.

Arief, S. German, S. Fletcher, R.F. Park, D. Singh, S. Pereyra, J. Franckowiak // Theor. Appl. Genet. – 2011. – V. 123. – № 1. – P. 55-68 Hou, Y.C. Genetic diversity in barley from west China based on RAPD and ISSR analysis / Y.C. Hou, Z.H. Yan, Y.L. Zheng // Barley Genetics Newsletter. – 2005. – V. 35. – P. 9-22.

Huang, Y. Differences in physiological traits among salt-stressed barley genotypes / Y. Huang, G. Zhang, F. Wu, J. Chen, M. Zhou // Commun. Soil Sci.

Plant Anal. – 2006. –V. 37. – № 3-4. – P. 557-570.

Hussain G., Al-Jaloud A.A., Al-Shammary S.A., Karimulla S., Al-Aswad S.O. Effect of saline irrigation on germination and growth parameters of barley (Hordeum vulgare L) in a pot experiment // Agric. Water Managm. – 1997. – V.

34. – № 2. – P. 125–135.

Ivandic, V. Molecular mapping of a new gene in wild barley conferring complete resistance to leaf rust (Puccinia hordei Otth) / V. Ivandic, U. Walther, A.

Graner // Theor. Appl. Genet. – 1998. – V. 97. – P. 1235-1239.

Jeli, M. The investigation of mineral nutrition of winter wheat growing in smonitza in degradation / M. Jeli // PhD thesis. Agricultural faculty Zernun. – 1996. – P. 1-121.

Johnston, W.H. Note on Keystone, a loose smut resistant feed barley / W.H.

Johnston, D.R. Metcalfe // Can. J. Plant. Sci. – 1961. – V. 41. – № 4. – P. 874-875.

Johnston, P.A. Rph22: mapping of a novel leaf rust resistance gene introgressed from the non-host Hordeum bulbosum L. into cultivated barley (Hordeum vulgare L.) / P.A. Johnston, R.E. Niks, V. Meiyalaghan, E. Blanchet, R.

Pickering // Theor. Appl. Genet. – 2013. – V. 126. – № 6. – P. 1613-1625.

Jorgensen, J.H. Discovery, characterization and exploitation of Mlo powdery mildew resistance in barley/ J.H. Jorgensen // Euphytica. – 1992. – V.63. – P. 141Jorgensen, H.J.L. Rhynchosporium seaclis, effect on yield, physiologic specialization and infection biology / H.J.L. Jorgensen // Ph.D. thesis. The Royal Veterinary and Agricultural University, Copenhagen. – 1992.

Jones, H. Population based re-sequencing reveals that the flowering time adaptation of cultivated barley originated east of the fertile crescent / H. Jones, F.J.

Leigh, I. Mackay, M. A. Bower, L. M.J. Smith, M. P. Charles, G. Jones, M. K.

Jones, T.A. Brown, W. Powell // Mol. Biol. Evol. 2008. – V. 25. № 10. – P. 2211Kastori, R. Effect of excess lead, cadmium, copper and zinc on water relations in sunflower / R. Kastori, M. Petrovi, N. Petrovi // J. Plant Nutr.1992. – V. 15. – P. 2427-2439.

Kastori, R. Effect of excess lead on sunflower growth and photosynthesis / R.

Kastori, M. Plesnicar, Z. Saka, D. Pankovi, I. Arsenijevi-Maksimovi // J. Plant Nutr. – 1998. – V. 21. – P. 75-85.

Kieckhefer, R.W. Yield losses in spring barley caused by cereal aphids (Homoptera: Aphididae) in South Dakota / R.W. Kieckhefer, B.H. Kantack // J.

Econ. Entomol. – 1986. – V. 79. – № 3. – P. 749-752.

Kikuchi, R. Molecular and functional characterization of PEBP genes in barley reveal the diversification of their roles in flowering / R. Kikuchi, H.

Kawahigashi, T.Ando, T. Tonooka, H. Handa // Plant Physiol. – 2009. – V. 149. – № 3. – P. 1341-1353.

Klee, C.B. Calmodulin / C.B. Klee, T.G. Vanaman // Adv. Protein Chem. – 1982. – V. 35. – P. 213-321.

Konzak, C.F. Inheritance of resistance in barley to physiologic races of Ustilago nuda / C.F. Konzak // Phytopathology. – 1953. – V. 43. – № 2. – P. 369Kozera, W. Inheritance of resistance to Ustilago nuda (Jens.) Rost, in moderately immune barley variety OAC-21 / W. Kozera // Genetica Polonica. – 1979. – V. 20. – № 1. – P. 65.

Laurie, D.A. Genetic analysis of a photoperiod response gene on the short arm of chromosome 2(2H) of Hordeum vulgare (barley) / D.A. Laurie, N.

Pratchett, J.H. Bezant, J.W. Snape // Heredity. – 1994. – V. 72. – № 6. – P. 619Laurie, D.A. RFLP mapping of five major genes and eight quantitative trait loci controlling flowering time in a winter x spring barley (Hordeum vulgare L.) cross / D.A. Laurie, N. Pratchett, J.H. Bezant, J.W. Snape // Genome. – 1995. – V.

38. – № 3. – P. 575-585.

Lehmensiek, A. Mapping of adult plant resistance to net form of net blotch in three Australian barley populations / A. Lehmensiek, G.J. Platz, E. Mace, D.

Poulsen, M.W. Sutherland // Austr. J. Agric. Res. – 2007. – V. 58. – P. 1191-1197.

Livingston, J.E. The inheritance of resistance to Ustilago nuda / J.E.

Livingston // Phytopathology. – 1942. – V. 32. – № 6. – P. 451-466.

Long, N.V. Association mapping of salt tolerance in barley (Hordeum vulgare L.) / N.V. Long, O. Dolstra, M. Malosetti, B. Kilian, A. Graner, R.G.F.

Visser, C.G. Van der Linden // Theor. Appl. Genet. – 2013. – V. 126. – № 9. – P.

2335–2351 Ma, Z.Q. QTL mapping of net blotch resistance genes in a doubled-haploid population of six-rowed barley / Z.Q. Ma, N.L.V. Lapitan, B.J. Steffenson // Euphytica. – 2004. – V. 137. – P. 291-296.

Manninen, O. Mapping of major spot-type and net-type net blotch resistance genes in the Ethiopian barley line CI 9819 / O. Manninen, M. Jalli, R. Kalendar, A. Schulman, O. Afanasenko, J. Robinson // Genome. – 2006. – V. 49. – P. 1564Mano, Y. Varietal variation in and effect of some major genes on salt tolerance at the germination stage in barley / Y. Mano, H. Nakazumi, K. Takeda // Breed Sci. – 1996. – V. 46. – P. 227-233.

Mano Y. Mapping quantitative trait loci for salt tolerance at germination and at the seedling stage of barley (Hordeum vulgare L) // Euphytica. – 1997. – V. 94.

– № 3. – P. 263-272.

Mano, Y. Genetic resources of salt tolerance in wild Hordeum species / Y.

Mano, K. Takeda // Euphytica. – 1998. – V. 103. – № 1. – P. 137-141.

Marschner, H. Mineral nutrition of higher plants / H. Marschner // Academic Press, London. – 1995. – 618 pp.

Martin, R.B. Bioinorganic chemistry of aluminum / R.B. Martin // In: H.

Sigel, A. Sigel (Eds) Metal ions in biological systems, Aluminum and its role in biology. Marcel Dekker, Inc., NY. – 1988. – V. 24. – P. 1-57.

McLean, F.T. The relative aluminum tolerance of crop plants / F.T. McLean, B.E. Gilbert // Soil Sci. – 1927. – V. 24. – P. 163-175.

Mer, R.K. Effect of salts on germination of seeds and growth of young plants of Hordeum vulgare, Triticum aestivum, Cicer arietinum and Brassica juncea / R.K. Mer, P.K. Prajith, D.H. Pandya, A.N. Pandey // J. Agron. Crop. Sci. – 2000. – V. 185. – № 4. – P. 209-217.

Merkle, O.G. Inheritance of a second source of greenbug resistance in barley / O.G. Merkle, J.A. Webster, G.H. Morgan // Crop Sci. 1987. V.27. №2. – P. 241Metcalfe, D.R. Inheritance of loose smut, covered smut and false loose smut in the barley variety Jet / D.R. Metcalfe // Can. J. Plant. Sci. – 1962. – V. 42. – № 1. – P. 176-189.

Metcalfe, D.R. Inheritance of loose smut. III. Relationships between the “Russian4” and “Jet” genes for resistance and genes in 10 barley varieties of diverse origin / D.R. Metcalfe // Can. J. Plant Sci. –1966. – V. 46. – № 5. – P.

487-495.

Miller, H.L. Involvement of ethylene in aphid infestation of barley / H.L.

Miller, P.A. Neese, D.L. Ketring, J.W. Dillwith // J. Plant Growth Regul. – 1994. – V. 13. – № 4. – P. 167-171.

Minella, E. Breeding barley for aluminum tolerance in Brazil / E. Minella, M.S. Silva // Abstr. V Int. Oat Conf. & VII Int. Barley Genetics Symposium. – 1996. – P. 528-529.

Minella, E. Inheritance and chromosome location of Alp, a gene controlling aluminum tolerance in Dayton barley / E. Minella, M.E. Sorrells // Plant Breed. – 1997. – V. 116. – №5. – P. 465-469.

Mode, C. Y. Two additional factors for host resistance to net blotch in barley / C.Y. Mode, C.W. Schaller // Agron. J. –1958. – V. 50. – P. 15-18.

Mohajir, A.R. Studies on the inheritance of loose smut resistance in spring barleys / A.R. Mohajir, D.C. Arny, H.G. Shands // Phytopathology. 1952, v. 42, № 7, pp. 367-373.

Moharramipour, S. Relationship between gramine concentration and cereal aphid populations in seedling and maturation stages in barley lines / S.

Moharramipour, S. Murata, K. Kanehisa, H. Tsumuki // Bull. Res. Inst.

Bioresour./Okayama Univ. – 1996. – V. 4. – № 1. – P. 49-58.

Moharramipour, S. Effects of leaf color, epicuticular wax amount and gramine content in barley hybrids on cereal aphid populations / S. Moharramipour, H. Tsumuki, S. Murata, K. Kanehisa // Appl. Entomol. Zool. – 1997a. – V. 32. – № 1. – P. 1-8.

Moharramipour, S. Mapping cereal aphid resistance in Steptoe/Morex doubled haploid population / S. Moharramipour, H. Yoshida, K. Sato, K. Takeda, T. Iida, H. Tsumuki // Barley Gen. Newsl. – 1997b. –V. 27. –P. 48-50.

Nei, M. Analysis of gene diversity in subdivided populations/ M. Nei // Proc.

Nat. Acad. Sci. USA. – 1973. – V. 70. – № 12. – P. 3321-3323.

Niks, R.E. Histology of the relation between minor and major genes for resistance of barley to leaf rust / R.E. Niks, H.J. Kuiper // Phytopathology. – 1983.

– V. 73. – № 1. – P. 55-59.

Patil, V. Molecular mapping a new gene Rrs4CII1549 for resistance to barley scald (Rhynchosporium secalis) / V. Patil, A. Bjrnstad, J. MacKey // Mol. Breed.

– 2003. –V. 12. – № 2. – P. 169-183.

Petrovi, N. The effect of cadmium on nitrate reductase activity in sugar beet (Beta vulgaris) / N. Petrovi, R. Kastori, I. Rajan // In: van Beusichem M.L. (Ed) Plant Nutrition, Physiology and Application. Kluwer Academic Publishers, Dordrecht, Boston, London. –1989. – P. 107-109.

Petrovi, N. Effect of cadmium and lead on the concentracion of macro-and microelements in sugar beet plants / N. Petrovi, R. Kastori, I. ArsenijeviMaksimovi // IXth International Colloquium for the Optimisation of Plant Nutrition, Prague. –1996. – P. 509-514.

Pickering, R. The transfer of a gene conferring resistance to scald (Rhynchosporium secalis) from Hordeum bulbosum into H. vulgare chromosome 4HS / R. Pickering, B. Ruge-Wehling, P.A. Johnston, G. Scweizer, P. Ackermann, P. Wehling // Plant Breed. – 2006. – V. 125. – № 6. – P. 576-579.

Piffanelli, P. A barley cultivation-associated polymorphism conveys resistance to powdery mildew / P. Piffanelli, L. Ramsay, R. Waugh, A.

Benabdelmouna, A. D’Hont, K. Hollricher, J.H. Jrgensen, P. Schulze-Lefert, R.

Panstruga // Nature. – 2004. – V. 430. – № 7002. – P. 887-891.

Porter, D.R. Differentiating greenbug resistance genes in barley / D.R. Porter, J.D. Burd, D.W. Mornhinweg // Euphytica. – 2007. – V. 153. – № 1-2. – P. 11-14.

Porter, D.R. New sources of resistance to greenbug in barley / D.R. Porter, D.W. Mornhinweg // Crop Sci. – 2004. – V. 44. – № 4. – P. 1245-1247.

Puterka, G.J. Designation of two new greenbug (Homoptera: Aphididae) biotypes G and H / G.J. Puterka, D.C. Peters, D.L. Kerns, J.E. Slosser, L. Bush, D.W. Worrall, R.W. McNew // J. Econ. Entomol. – 1988. – V. 81. – № 6. – P.

1754-1759.

Puthota, V. An ultrastructural study of the inhibition of mucilage, reaction in the wheat root cap by aluminium / V. Puthota, R. Cruz-Ortega, J.J. Johnson, J.

Ownby // In: R. J. Wright, V.C. Baligar, R.P. Murrmami (Eds). Plant-soil interactions at low pH. Kluwer Academic Publishers, Dordrecht. The Netherlands.

– 1991. – P. 779-787.

Qi, X. The evidence for abundance of QTLs for partial resistance to Puccinia hordei on the barley genome / X. Qi, F. Fufa, D. Sijtsma, R.E. Niks, P. Lindhout, P. Stam // Molecular Breeding. – 2000. – V. 6. – № 1. – P. 1-9.

Qi, X. Identification of QTLs for partial resistance to leaf rust (Puccinia hordei ) in barley / X. Qi, R.E. Niks, P. Stam, P. Lindhout // Theor. Appl. Genet.

– 1998. – V. 96. – № 8. – P. 1205-1215.

Rauser, W.E. Retention of cadmium in roots of maize seedlings / W.E.

Rauser, P. Meuwly // Plant Physiol. – 1995. – V. 109. – P. 195-202.

Reinstdler, A. Novel induced mlo mutant alleles in combination with sitedirected mutagenesis reveal functionally important domains in the heptahelical barley Mlo protein / A. Reinstdler, J. Mller, H. Jerzy, J.H. Czembor, P.

Piffanelli, R. Panstruga // Plant Biology – 2010, – V.10. – N31. – P.1471-2229 Reitan, L. Characterization of resistance genes against scald (Rhynchosporium secalis (Oud.) J. J. Davis) in barley (Hordeum vulgare L.) lines from central Norway by means of genetic markers and pathotype tests / L. Reitan, S. Grnnerd, T.P. Ristad, S. Salamati, H. Skinnes, R. Waugh,. Bjrnstad // Euphytica. – 2002. – V. 123. – № 1. – P. 31-39.

Ried, D.A. Genetic control of reaction to aluminum in winter barley / D.A.

Ried // In R.A. Nilan (ed.) Barley genetics II. Washington State Universsity Press.

– 1979. –P. 409-413.

Robertson, D.W. A summary of linkage studies in barley. Supplement I, 1940–1946 / D.W. Robertson, G.A. Wiebe, R.G. Schands // J. Amer. Soc. Agron. – 1947. – V. 39. – № 6. – P. 464-473.

Rohe, M. The race-specific elicitor, NIP1, from the barley pathogen, Rhynchosporium secalis, determines avirulence on host plants of the Rrs1 resistance genotype / M. Rohe, A. Gierlich, H. Hermann, M. Hahn, B. Schmidt, S.

Rosahl, W. Knogge // EMBO J. – 1995. – V. 14. – № 17. – P. 4168-4177.

Roy, J. K. Associating mapping of spot blotch resistance in wild barley // J.K.

Roy, K.P. Smith, G.J. Muehlbauer, S. Chao, T.J. Close, B.J. Steffenson // Molec.

Breed. – 2010. – V. 26. – № 2. – P. 243-256.

Sandhu, K.S. Inheritance and molecular mapping of a gene conferring seedling resistance against Puccinia hordei in the barley cultivar Ricardo / K.S.

Sandhu, K.L. Forrest, S. Kong, U.K. Bansal, D. Singh, M.J. Hayden, R.F. Park // Theor. Appl. Genet. – 2012. – V. 125. – № 7. – P. 1403–1411.

Schaller, C.W. Inheritance of resistance to loose smut, Ustilago nuda, in barley / C.W. Schaller // Phytopathology. – 1949. – V. 39. – № 12. – P. 959-979.

Schaller, C. W. Inheritance of resistance to net blotch of barley / C.W.

Schaller // Phytopathology. – 1955. – V. 45. – P. 174-176.

Schrch, S. Molecular population genetic analysis differentiates two virulence mechanisms of the fungal avirulence gene NIP1 / S. Schrch, C.C. Linde, W.

Knogge, L.F. Jackson, B.A. McDonald // Mol. Plant-Microbe Inter. – 2004. – V.

17. – № 10. – P. 1114-1125.

Schweitzer, G.F. Genetic mapping of a novel scald resistance gene Rrsl5 CI8288 in barley

Abstract

9" / G.F. Schweitzer, M. Herz, S. Mikolajeewski, M.

Bremner, L. Hartl, M. Baumer // Intern. Barley Genet; Sympos., Brno. – 2004.

Shands, R.G. Inheritance and linkage of stem rust and loose smut resistance and starch type in barley / R.G. Shands // Phytopathology. – 1964. – V. 54. – № 3.

– P. 308-316.

Shands, H. Inheritance of resistance to loose smut in three winter barleys / H.

Shands, F.L. Patterson, J.F. Schafer // Proc. Ind. Acad. Sci. 1964. V. 74. № 2. P.

155- 164.

Shtaya, M.J.Y. Identification of a new pathotype of Puccinia hordei with virulence for the resistance gene Rph7 / M.J.Y. Shtaya, J.C. Sillero, D. Rubiales // Eur. J. Plant Pathol. – 2006. – V. 116. – № 2. – P. 103-106 Sidhu, G. Genetic control of virulence in Ustilago hordei. II Segregations for higher levels of virulence / G. Sidhu, C. Person // Can. J. Genet. Cytol. – 1971. – V. 13. – № 2. – P. 173-178.

Sidhu, G. Genetic control of virulence in Ustilago hordei. III. Identification of genes for host resistance and demonstration of gene-for-gene relations / G. Sidhu, C. Person // Can J. Genet Cytol. – 1972. – V. 14. – № 2. – P. 209-213.

Skou, J.P. Comparative studies on callose formation in powdery mildew compatible and incompatible barley / J.P. Skou, J.H. Jrgensen, U. Lilholt // Phytopathol. Z. – (1984) – V.109 – P.147–168.

laski, J.J. Effect of aluminium on calmodulin-dependent and calmodulinindependent NAD kinase activity in wheat root tips / J.J. laski // J. Plant Physiol.

– 1989. – V. 133. – P. 696-701.

Smedegard-Petersen V. Isolation of two toxins produced by Pyrenophora teres and their significance in disease development of net-spot blotch of barley // Phys. Plant Pathol. – 1977. – V.10. – P. 209-214.

Smilde, W. D. Development of a high resolution map for the Rh and Pt resistance on barley chromosome 3H / W.D. Smilde, A. Tekauz, A. Graner // Proc.

8th Intern. Barley Genet. Symp. – Adelaide, 2000. – P. 178-180.

Smith, C.M. The molecular bases of plant resistance and defense responses to aphid feeding: current status / C.M. Smith, E.V. Boyko // Entomol. Exp. et Appl. – 2007. – V. 122. – № 1. – P. 1-16.

Smith, O.D. Inheritance studies of greenbug (Toxoptera graminum Rond.) resistance in four varieties of winter barley / O.D. Smith, A.M. Schlehuber, B.C.

Curtis // Crop Sci. – 1962. – V. 2. – P. 489-491.

Steffenson, B.J. Investigations on Pyrenophora teres f. teres, the cause of net blotch of barley: pathotypes, host resistance, yield loss, and comparative epidemiology to Rhynchosporium secalis by time series analysis / B.J. Steffenson // Ph. D. Thesis, University of California Davis, USA. – 1988. – 88 p.

Steffenson, B.J. Durable resistance to spot blotch and stem rust in barley / B.J. Steffenson // Proc. 8th Intern. Barley Genet. Symp. (22-27 October 2000). – Adelaide, 2000. – P. 39-44.

Steffenson, B.J. Genetics of seedling and adult plant resistance to net blotch (Pyrenophora teres f. teres) and spot blotch (Cochliobolus sativus) in barley / B.J.

Steffenson, P.M. Hayes, A. Kleinhofs // Theor. Appl. Gen. – 1996. – V. 92. – P.

552-558.

Steffenson, B.J. Pathotypes of Puccinia hordei with virulence for the barley leaf rust resistance gene Rph7 in the United States / B.J. Steffenson, Y. Jin, C.A.

Griffey // Plant Dis. – 1993. – V. 77. – № 9. – P. 867-869.

Tan, В.Н. Verifying the genetic relationships between three leaf rust resistance genes in barley / В.Н. Tan // Euphytica. – 1978. – V. 27. – P. 317-323.

Takahashi, R. Genetic studies of spring and winter habit of growth in barley / R. Takahashi, S. Yasuda // Ber. Ohara Inst. – 1956. – V. 10. – P. 245-308.

Takahashi, R. Genetics of earliness and growth habit in barley / R. Takahashi, S. Yasuda // Barley Genetics II. Proc. 2nd Intern. Barley Genetics Symp.

Washington State Univ. Press. – 1971. – P. 388-408.

Tang, Y. Identification of RFLP markers linked to the barley aluminum tolerance gene Alp / Y. Tang, M.E. Sorells, L.V. Kochian, D.F. Garvin // Crop Sci.

– 2000. – V. 40. – P. 778-782.

Tekauz, A. A numerical scale to classify reactions of barley to Pyrenophora teres / A. Tekauz // Canad. J. Plant Pathol. – 1985. – V. 7. – № 2. – P. 181-183.

Teylor, G.J. The physiology of aluminum tolerance in higher plants / G.J.

Teylor // Comm. Soil Sci. Plant Anal. – 1988. – V. 19. – P. 1179- 1194.

Thomas, P.L. Occurence of loose smut of barley in commercially grown cultivars possessing genes for resistance from Jet / P.L. Thomas // Can. J. Plant.

Sci., 1974, – v. 54. – № 3. – pp. 453-456.

Trehan, K.B. Note on genetic stocks of barley (Hordeum vulgare L.) resistant to the aphid Rhopalosiphum maidis (Fitch.) / K.B. Trehan, V.K. Bhatragar, R.C.

Sharma, R.P. Chandola // Indian J. Agric. Sci. – 1970. – V. 40. – № 8. – P. 756Tsumuki, H. Leaf surface wax as a possible resistance factor of barley to cereal aphids / H. Tsumuki, K. Kanehisa, K. Kawada // Appl. Entomol. Zool. – 1989. – V. 24. – № 3. – P. 295-301.

Turner, A. The pseudo- response regulator Ppd-H1 provides adaptation to photoperiod in barley / A. Turner, J. Beales, S. Faure, R.P. Dunford, D.A. Laurie // Science. – 2005. – V. 310. – № 570. – P. 1031-1033.

Yasuda, S. Linkage of the earliness gene eak and its pleiotropic effects under different growth conditions / S. Yasuda // Berichte des Ohara Institutes fr landwirtschaftliche Biologie. Okayama Universitt. – 1977. – V. 17. – P. 15-28.

Yoshida, H. Mapping a gene for gramine synthesis in barley / H. Yoshid, T.

Iida, K. Sato, S. Moharramipour, H. Tsumuki // Barley Genet. Newsl. – 1997. – V.

27. – P. 22–24.

Yun, S. J. Quantitative trait loci for multiple disease resistance in wild barley / S.J. Yun, L. Gyenis, P.M. Hayes, I. Matus, K.P. Smith, B.J. Steffenson, G.J.

Muehlbauer // Crop Sci. – 2005. – V. 45, № 6. – P. 2563-2572.

Wagatsuma, T. Relationship between differential aluminum tolerance and plant induced pH change of medium among barley cultivars / T. Wagatsuma, K.

Yamasaku // Soil Sci. Plant Nutr. – 1985. – V. 31. – P. 521-535.

Weerasena, J.S. Conversion of an amplified fragment length polymorphism marker into a codominant marker in the mapping of the Rph15 gene conferring resistance to barley leaf rust, Puccinia hordei Otth. / J.S. Weerasena, B.J.

Steffenson, A.B. Falk // Theor. Appl. Genet. – 2004. – V. 108. – № 4. – P. 712Weibull, J. Diversity in resistance to biotic stresses / J. Weibull, U. Walther, K. Sato, A. Habeku, D. Kopahnke, G. Proeseler // Diversity in Barley (Hordeum vulgare). Elsevier, – 2003. – P. 143-178.

Wells, S.A. Inheritance of reaction to Ustilago hordei (Pers.) Lagerh. in cultivated barley / S.A. Wells // Can. J. Plant. Sci. – 1958. – V. 38. – № 1. – P. 45Wells S.A. Inheritance of reaction to Rhynchosporium secalis in barley / S.A.

Wells, W.P. Scoropad // Can. J. Plant Sci. – 1963. – V. 43. – P. 184-187.

Williams, K. Determing the genetics of leaf scald and spot from of net blotch resistance using molecular markers / K. Williams, R. Genger, T. Brown, H.

Wallwork // Proc. Second Int. Workshop Barley Leaf Blight. ICARDA. 2002. – P.

195-199.

Williams, K. J. Identification and mapping of a gene conferring resistance to the spot form of net blotch (Pyrenophora teres f. maculata) in barley / K.J.

Williams, A. Lichon, P. Gianquitto, J.M.Kretschmer, A. Karkousis, S. Manning, P.

Langridge, H. Wallwork // Theor. Appl. Genet. – 1999. – V. 99. – P. 323-327.

Winicov, I. New molecular approaches to improving salt tolerance in crop plants / I. Winicov // Ann. Bot. – 1998. – V. 82. – № 6. – P. 703-710.

Wolter, M. The mlo resistance alleles to powdery mildew infection in barley trigger a developmentally controlled defense mimic phenotype/ M. Wolter, K.

Hollricher, F. Salamini, P. Schulze-Lefert // Mol. Gen. Genet. –1993 –V. 239 – P.122-128.

Xue, D. Identification of QTLs associated with salinity tolerance at late growth stage in barley / D. Xue, Y. Huang, X. Zhang, K. Wei, S. Westcott, C. Li, M. Chen, G. Zhang, R. Lance // Euphytica. – 2009. – V. 169. – № 2. – P. 187-196.

Yasuda, S. Linkage of the earliness gene eak and its pleiotropic effects under different growth conditions / S. Yasuda // Berichte des Ohara Institutes fr landwirtschaftliche Biologie. Okayama Universitt. – 1977. – V. 17. – P. 15-28.

Zakhrabekova, S. Induced mutations in circadian clock regulator Mat-a facilitated short-season adaptation and range extension in cultivated barley / S.

Zakhrabekova, S. P. Gough, I. Braumann, A. H. Mller, J. Lundqvist, K.

Ahmann, C. Dockter, I. Matyszczak, M. Kurowska, A. Druka, R. Waugh, A.

Graner, N. Stein, B. Steuernagel, U. Lundqvist, M. Hansson // Proc. Natl. Acad.

Sci. – 2012. – V. 109. – № 11. – P. 4326-4331.

Zhong, S.B. Molecular mapping of the leaf rust resistance gene Rph6 in barley and its linkage relationships with Rph5 and Rph7 / S.B.Zhong, R.J. Effertz, Y. Jin, J.D. Franckowiak, B.J. Steffenson // Phytopathology. – 2003. – V. 93. – P.

604-609.

Ziems, L.A. Association mapping of resistance to Puccinia hordei in Australian barley breeding germplasm / L.A. Ziems, L.T. Hickey, C.H. Hunt, E.S.

Mace, G.J. Platz, J.D. Franckowiak, D.R. Jordan // Theor. Appl. Genet. – 2014. – V. 127. – № 5. – P. 1199-1212.



Pages:     | 1 ||
Похожие работы:

«Учреждение Российской академии наук Институт природных ресурсов, экологии и криологии СО РАН Министерство образования, науки и молодежной политики Забайкальского края Забайкальский государственный гуманитарно-педагогический университет им. Н.Г. Чернышевског...»

«Менеджмент ности. Можно с уверенностью сказать, что производитель, сумевший уяснить направленность потребительских предпочтений на экологически чистую и гарантированно качественную продукцию, в ближайшее время станет сильным, конкурентоспособным уч...»

«Труды Никитского ботанического сада. 2011. Том 133 ВЛИЯНИЕ ПОЧВЕННОГО ПИТАНИЯ НА ФОРМИРОВАНИЕ УРОЖАЯ, ПИГМЕНТНЫЙ СОСТАВ ЛИСТЬЕВ И ВЫХОД ЭФИРНОГО МАСЛА NEPETA CATARIA VAR. CITRIODORA BECK. И.Н. ПАЛИЙ; О.А. ИЛЬНИЦКИЙ, доктор биологических наук Никитский ботанический сад – Национальный научный це...»

«Геоэкология ЧЕРНЫЕ ЗЕМЛИ КАЛМЫКИИ: КОМПЛЕКСНЫЕ ИССЛЕДОВАНИЯ И РАЗРАБОТКА ГИС Ташнинова Людмила Николаевна, кандидат биологических наук Институт аридных зон Южного научного центра РАН 358000, Российская Федерация, Республика Калмыкия, г. Элиста, ул. Илишкина, 8. E-mail: annatashninova@mail.ru Буваев Дмитрий Алексеевич, аспирант Инст...»

«МУНИЦИПАЛЬНОЕ БЮДЖЕТНОЕ ОБЩЕОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ "ЛИЦЕЙ №36" Г. КАЛУГИ РАЗВИТИЕ В УСЛОВИЯХ НЕДОСТАТКА ЙОДА В ПИЩЕ И ВОДЕ Автор работы: Левченко Алина, ученица 10 "Б" класса e-mail: lina.levchencko@yandex.ru Научный руководитель: Андрейчук Ольга Юрьевна, учитель биологии первой...»

«Консультация для родителей на тему: "5 способов укрепить иммунитет ребенка осенью" Современные дети болеют часто. "Иммунитет ослаблен", – жалуются мамы, выстаивая очереди в поликлиниках. Можно сколько угодно списывать проблемы на экологию, но факт остается фактом: мно...»

«Труды Никитского ботанического сада. 2010. Том 132 СОРТА НЕКТАРИНА И ПОДВОИ КОСТОЧКОВЫХ В НИКИТСКОМ БОТАНИЧЕСКОМ САДУ Е.П. ШОФЕРИСТОВ, доктор биологических наук Никитский ботанический сад – Национальный научный центр Введение Крупноплодные сорта нектарина завоевали большую популярность в мирово...»

«СКУРАТОВА ЛИЛИЯ СЕРГЕЕВНА ОСОБЕННОСТИ АРХИТЕКТУРНО-ХУДОЖЕСТВЕННОЙ СРЕДЫ СОВРЕМЕННЫХ ЗООЛОГИЧЕСКИХ ПАРКОВ (на примере зоопарков Сибири) Специальность 17.00.04 Изобразительное искусство, декоративно-прикладное искусство и архитектура АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата искусс...»

«ТЕМА 1. ЧЕЛОВЕК И ОБЩЕСТВО # Человек как результат биологической и социокультурной эволюции # Социализация индивида # Деятельность # Познание мира # Общество как форма жизнедеятельности людей # Духовная культура общества # Итоговое повто...»

«АДМИНИСТРАЦИЯ СЕЛЬСКОГО ПОСЕЛЕНИЯ ВЕСЕЛЁВСКОЕ НАРО-ФОМИНСКОГО МУНИЦИПАЛЬНОГО РАЙОНА МОСКОВСКОЙ ОБЛАСТИ РАСПОРЯЖЕНИЕ от _13.01.2015_№ 2-р д. Веселево Об утверждении формы справки о доходах, расходах, об имуществе и обязательствах имущественного характер...»

«контроль радиорезистентности микрофлоры на производствах, где применяется радиационный метод стерилизации. В принципе подобная методика должна включать следующие этапы работы: 1) выделение производственной микрофлоры; 2) облучение смешанных культур в суббактерицидных дозах излучения с целью селекци...»

«Труды Никитского ботанического сада. 2011. Том 133 5 НОВЫЕ СОРТА АРОМАТИЧЕСКИХ И ЛЕКАРСТВЕННЫХ РАСТЕНИЙ СЕЛЕКЦИИ НИКИТСКОГО БОТАНИЧЕСКОГО САДА В.Д. РАБОТЯГОВ, доктор биологических наук; Л.А. ХЛЫПЕНКО, кандидат сельскохозяйственных наук; Л.В. СВИДЕНКО, кандидат биологических наук; И.Е. ЛОГВИНЕНКО, кандидат биологических н...»

«УДК 551.5 + 553 : 330.15 (477.61/62) С. Ф. Марова1, Т. Н. Ткаченко2 НАПРАВЛЕНИЯ РАБОТ ПО БИОЛОГИЧЕСКОЙ ОПТИМИЗАЦИИ ГОРОДСКИХ ТЕРРИТОРИЙ ДонДУУ, 2ДонНАСА Марова С. Ф., Ткаченко Т. Н. Направления работ по биологи...»

«СПОРЫ ГРИБОВ: ПОКОЙ, ПРОРАСТАНИЕ, ХИМИЧЕСКИЙ СОСТАВ И ЗНАЧЕНИЕ ДЛЯ БИОТЕХНОЛОГИИ (ОБЗОР) © 2012 г. Е. П. Феофилова*, А. А. Ивашечкин**, А. И. Алёхин***, Я. Э. Сергеева* *Институт микробиологии им. С.И. Виноградского РАН, Москва, 117312 e-mail: biologl@migmail.ru **Московский государственный университет...»

«Биокарта Paramesotriton chinensis ТРИТОН БОРОДАВЧАТЫЙ КИТАЙСКИЙ Paramesotriton chinensis Chinese Warty Newt Составили: Нуникян Е.Ф. Дата последнего обновления: 29.10.11 1. Биология и полевые данные 1.1 Таксономия Отряд Хвостатые Caudata Семейство Саламандры Salamandridae По...»

«КОНВЕРГЕНЦИЯ НАУК И ТЕХНОЛОГИЙ – НОВЫЙ ЭТАП НАУЧНОТЕХНИЧЕСКОГО РАЗВИТИЯ Ковальчук М.В., Нарайкин О.С., Яцишина Е.Б. В конце XX в. цивилизационный кризис перешёл в новую – системную – фазу, сегодня он охватывает по сути все о...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ ФГБУ "Специализированный центр учета в агропромышленном комплексе" ИНФОРМАЦИОННЫЙ ОБЗОР НОВОСТИ АПК: РОССИЯ И МИР итоги, прогнозы, события № 03-12-12 (1222) ФГБУ "СПЕЦЦЕНТУЧЕТ В АПК" МОНИТОРИНГ СМИ ОТ 03.12.2012 Г. СОДЕРЖАНИЕ ВЫПУСКА: 1. ТОП-БЛОК...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Ярославский государственный университет им. П.Г. Демидова Факультет биологии и экологии УТВЕРЖДАЮ Декан факультета биологии и экологии _ _2014 г. Программа вступительного экзамена в аспирантуру по напр...»

«Биокарта Neurergus kaiseri ЗАГРОССКИЙ ТРИТОН Neurergus kaiseri Lorestan Newt, Luristan Newt, Emperor Spotted Newt, Zagros Newt, Iranian Harlequin Newt, Kaiser Newt Составили: Нуникян Е.Ф. Дата последнего...»

«Труды Никитского ботанического сада. 2011. Том 133 209 ИТОГИ ИНТРОДУКЦИИ И СЕЛЕКЦИИ ARTEMISIA BALCHANORUM KRASCH. В СТЕПНОЙ ЗОНЕ ЮГА УКРАИНЫ Л.В.СВИДЕНКО, кандидат биологических наук; Никитский бота...»

«СЕЛЬСКОХОЗЯЙСТВЕННЫЕ НАУКИ УДК 576.895.122.21 (282.247.36) (470.324) КАРПОВЫЕ РЫБЫ КАК ИСТОЧНИК ЗАРАЖЕНИЯ ЧЕЛОВЕКА И ДОМАШНИХ ЖИВОТНЫХ ОПИСТОРХОЗОМ В ВОРОНЕЖСКОЙ ОБЛАСТИ Елена Николаевна Ромашова, аспирант кафедры паразитологии и эпизоотологии Воронежский...»

«1005459 ЭФФЕКТИВНЫЕ ЭРГОНОМИЧНЫЕ ЭКОЛОГИЧНЫЕ ЖИВОТНОВОДЧЕСКИЕ КОМПЛЕКСЫ НОВОГО ТЫСЯЧЕЛЕТИЯ WWW.YASNOGORFARMS.RU вешала PELLON © KRAI BURG У' SUEVIA CHHORMANN I ФЕРМЫ Уважаемые д а м ы и гос...»

«СЕЛЬСКОХОЗЯЙСТВЕННЫЕ НАУКИ The podtaezhnaja zone of the Omsk region represents extensive lowland, raschle-nennuju river valleys with flat megdurechymi and bogs. Gray wood soils for-nimajut 18% of territory of a zone, also are wid...»

«Известия Музейного Фонда им. А.А.Браунера № 3-4 Том VII 2010 Известия Музейного Фонда им. А. А. Браунера Том VII № 3-4 2010 Научный журнал Основан в декабре 2003 г. Выходит 4 раза в год Свиде...»









 
2017 www.doc.knigi-x.ru - «Бесплатная электронная библиотека - различные документы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.